ID: 1157424320

View in Genome Browser
Species Human (GRCh38)
Location 18:47571883-47571905
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157424320_1157424329 -3 Left 1157424320 18:47571883-47571905 CCCTGAGTCCCCCTGAGTCCCCT No data
Right 1157424329 18:47571903-47571925 CCTGAGATATGTGCCTCTCCAGG No data
1157424320_1157424334 25 Left 1157424320 18:47571883-47571905 CCCTGAGTCCCCCTGAGTCCCCT No data
Right 1157424334 18:47571931-47571953 AAGAGTCCCAGTCCTCCTCTAGG No data
1157424320_1157424330 -2 Left 1157424320 18:47571883-47571905 CCCTGAGTCCCCCTGAGTCCCCT No data
Right 1157424330 18:47571904-47571926 CTGAGATATGTGCCTCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157424320 Original CRISPR AGGGGACTCAGGGGGACTCA GGG (reversed) Intergenic
No off target data available for this crispr