ID: 1157424323

View in Genome Browser
Species Human (GRCh38)
Location 18:47571892-47571914
Sequence ACATATCTCAGGGGACTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157424323_1157424334 16 Left 1157424323 18:47571892-47571914 CCCCTGAGTCCCCTGAGATATGT No data
Right 1157424334 18:47571931-47571953 AAGAGTCCCAGTCCTCCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157424323 Original CRISPR ACATATCTCAGGGGACTCAG GGG (reversed) Intergenic
No off target data available for this crispr