ID: 1157424326

View in Genome Browser
Species Human (GRCh38)
Location 18:47571901-47571923
Sequence TGGAGAGGCACATATCTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157424326_1157424334 7 Left 1157424326 18:47571901-47571923 CCCCTGAGATATGTGCCTCTCCA No data
Right 1157424334 18:47571931-47571953 AAGAGTCCCAGTCCTCCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157424326 Original CRISPR TGGAGAGGCACATATCTCAG GGG (reversed) Intergenic
No off target data available for this crispr