ID: 1157424329

View in Genome Browser
Species Human (GRCh38)
Location 18:47571903-47571925
Sequence CCTGAGATATGTGCCTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157424318_1157424329 5 Left 1157424318 18:47571875-47571897 CCCTGAGTCCCTGAGTCCCCCTG No data
Right 1157424329 18:47571903-47571925 CCTGAGATATGTGCCTCTCCAGG No data
1157424319_1157424329 4 Left 1157424319 18:47571876-47571898 CCTGAGTCCCTGAGTCCCCCTGA No data
Right 1157424329 18:47571903-47571925 CCTGAGATATGTGCCTCTCCAGG No data
1157424316_1157424329 10 Left 1157424316 18:47571870-47571892 CCTGCCCCTGAGTCCCTGAGTCC No data
Right 1157424329 18:47571903-47571925 CCTGAGATATGTGCCTCTCCAGG No data
1157424320_1157424329 -3 Left 1157424320 18:47571883-47571905 CCCTGAGTCCCCCTGAGTCCCCT No data
Right 1157424329 18:47571903-47571925 CCTGAGATATGTGCCTCTCCAGG No data
1157424315_1157424329 16 Left 1157424315 18:47571864-47571886 CCAGATCCTGCCCCTGAGTCCCT No data
Right 1157424329 18:47571903-47571925 CCTGAGATATGTGCCTCTCCAGG No data
1157424321_1157424329 -4 Left 1157424321 18:47571884-47571906 CCTGAGTCCCCCTGAGTCCCCTG No data
Right 1157424329 18:47571903-47571925 CCTGAGATATGTGCCTCTCCAGG No data
1157424317_1157424329 6 Left 1157424317 18:47571874-47571896 CCCCTGAGTCCCTGAGTCCCCCT No data
Right 1157424329 18:47571903-47571925 CCTGAGATATGTGCCTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157424329 Original CRISPR CCTGAGATATGTGCCTCTCC AGG Intergenic
No off target data available for this crispr