ID: 1157424334

View in Genome Browser
Species Human (GRCh38)
Location 18:47571931-47571953
Sequence AAGAGTCCCAGTCCTCCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157424322_1157424334 17 Left 1157424322 18:47571891-47571913 CCCCCTGAGTCCCCTGAGATATG No data
Right 1157424334 18:47571931-47571953 AAGAGTCCCAGTCCTCCTCTAGG No data
1157424326_1157424334 7 Left 1157424326 18:47571901-47571923 CCCCTGAGATATGTGCCTCTCCA No data
Right 1157424334 18:47571931-47571953 AAGAGTCCCAGTCCTCCTCTAGG No data
1157424321_1157424334 24 Left 1157424321 18:47571884-47571906 CCTGAGTCCCCCTGAGTCCCCTG No data
Right 1157424334 18:47571931-47571953 AAGAGTCCCAGTCCTCCTCTAGG No data
1157424327_1157424334 6 Left 1157424327 18:47571902-47571924 CCCTGAGATATGTGCCTCTCCAG No data
Right 1157424334 18:47571931-47571953 AAGAGTCCCAGTCCTCCTCTAGG No data
1157424320_1157424334 25 Left 1157424320 18:47571883-47571905 CCCTGAGTCCCCCTGAGTCCCCT No data
Right 1157424334 18:47571931-47571953 AAGAGTCCCAGTCCTCCTCTAGG No data
1157424323_1157424334 16 Left 1157424323 18:47571892-47571914 CCCCTGAGTCCCCTGAGATATGT No data
Right 1157424334 18:47571931-47571953 AAGAGTCCCAGTCCTCCTCTAGG No data
1157424325_1157424334 14 Left 1157424325 18:47571894-47571916 CCTGAGTCCCCTGAGATATGTGC No data
Right 1157424334 18:47571931-47571953 AAGAGTCCCAGTCCTCCTCTAGG No data
1157424328_1157424334 5 Left 1157424328 18:47571903-47571925 CCTGAGATATGTGCCTCTCCAGG No data
Right 1157424334 18:47571931-47571953 AAGAGTCCCAGTCCTCCTCTAGG No data
1157424331_1157424334 -8 Left 1157424331 18:47571916-47571938 CCTCTCCAGGGTCCAAAGAGTCC No data
Right 1157424334 18:47571931-47571953 AAGAGTCCCAGTCCTCCTCTAGG No data
1157424324_1157424334 15 Left 1157424324 18:47571893-47571915 CCCTGAGTCCCCTGAGATATGTG No data
Right 1157424334 18:47571931-47571953 AAGAGTCCCAGTCCTCCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157424334 Original CRISPR AAGAGTCCCAGTCCTCCTCT AGG Intergenic
No off target data available for this crispr