ID: 1157426047

View in Genome Browser
Species Human (GRCh38)
Location 18:47585099-47585121
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157426047_1157426054 2 Left 1157426047 18:47585099-47585121 CCACCTATAGCCTTTGGTCCAGC No data
Right 1157426054 18:47585124-47585146 CCTGGTAAAACACACACCTGTGG No data
1157426047_1157426059 26 Left 1157426047 18:47585099-47585121 CCACCTATAGCCTTTGGTCCAGC No data
Right 1157426059 18:47585148-47585170 CACCCACAGCACCCTGGGTCTGG No data
1157426047_1157426060 27 Left 1157426047 18:47585099-47585121 CCACCTATAGCCTTTGGTCCAGC No data
Right 1157426060 18:47585149-47585171 ACCCACAGCACCCTGGGTCTGGG No data
1157426047_1157426055 3 Left 1157426047 18:47585099-47585121 CCACCTATAGCCTTTGGTCCAGC No data
Right 1157426055 18:47585125-47585147 CTGGTAAAACACACACCTGTGGG No data
1157426047_1157426058 21 Left 1157426047 18:47585099-47585121 CCACCTATAGCCTTTGGTCCAGC No data
Right 1157426058 18:47585143-47585165 GTGGGCACCCACAGCACCCTGGG No data
1157426047_1157426057 20 Left 1157426047 18:47585099-47585121 CCACCTATAGCCTTTGGTCCAGC No data
Right 1157426057 18:47585142-47585164 TGTGGGCACCCACAGCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157426047 Original CRISPR GCTGGACCAAAGGCTATAGG TGG (reversed) Intergenic
No off target data available for this crispr