ID: 1157426052

View in Genome Browser
Species Human (GRCh38)
Location 18:47585123-47585145
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157426052_1157426065 10 Left 1157426052 18:47585123-47585145 CCCTGGTAAAACACACACCTGTG No data
Right 1157426065 18:47585156-47585178 GCACCCTGGGTCTGGGAGAGGGG No data
1157426052_1157426070 20 Left 1157426052 18:47585123-47585145 CCCTGGTAAAACACACACCTGTG No data
Right 1157426070 18:47585166-47585188 TCTGGGAGAGGGGGTGCAGGTGG No data
1157426052_1157426059 2 Left 1157426052 18:47585123-47585145 CCCTGGTAAAACACACACCTGTG No data
Right 1157426059 18:47585148-47585170 CACCCACAGCACCCTGGGTCTGG No data
1157426052_1157426057 -4 Left 1157426052 18:47585123-47585145 CCCTGGTAAAACACACACCTGTG No data
Right 1157426057 18:47585142-47585164 TGTGGGCACCCACAGCACCCTGG No data
1157426052_1157426069 17 Left 1157426052 18:47585123-47585145 CCCTGGTAAAACACACACCTGTG No data
Right 1157426069 18:47585163-47585185 GGGTCTGGGAGAGGGGGTGCAGG No data
1157426052_1157426064 9 Left 1157426052 18:47585123-47585145 CCCTGGTAAAACACACACCTGTG No data
Right 1157426064 18:47585155-47585177 AGCACCCTGGGTCTGGGAGAGGG No data
1157426052_1157426066 11 Left 1157426052 18:47585123-47585145 CCCTGGTAAAACACACACCTGTG No data
Right 1157426066 18:47585157-47585179 CACCCTGGGTCTGGGAGAGGGGG No data
1157426052_1157426058 -3 Left 1157426052 18:47585123-47585145 CCCTGGTAAAACACACACCTGTG No data
Right 1157426058 18:47585143-47585165 GTGGGCACCCACAGCACCCTGGG No data
1157426052_1157426063 8 Left 1157426052 18:47585123-47585145 CCCTGGTAAAACACACACCTGTG No data
Right 1157426063 18:47585154-47585176 CAGCACCCTGGGTCTGGGAGAGG No data
1157426052_1157426071 28 Left 1157426052 18:47585123-47585145 CCCTGGTAAAACACACACCTGTG No data
Right 1157426071 18:47585174-47585196 AGGGGGTGCAGGTGGTCACTCGG No data
1157426052_1157426060 3 Left 1157426052 18:47585123-47585145 CCCTGGTAAAACACACACCTGTG No data
Right 1157426060 18:47585149-47585171 ACCCACAGCACCCTGGGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157426052 Original CRISPR CACAGGTGTGTGTTTTACCA GGG (reversed) Intergenic
No off target data available for this crispr