ID: 1157426059

View in Genome Browser
Species Human (GRCh38)
Location 18:47585148-47585170
Sequence CACCCACAGCACCCTGGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157426052_1157426059 2 Left 1157426052 18:47585123-47585145 CCCTGGTAAAACACACACCTGTG No data
Right 1157426059 18:47585148-47585170 CACCCACAGCACCCTGGGTCTGG No data
1157426048_1157426059 23 Left 1157426048 18:47585102-47585124 CCTATAGCCTTTGGTCCAGCTCC No data
Right 1157426059 18:47585148-47585170 CACCCACAGCACCCTGGGTCTGG No data
1157426050_1157426059 16 Left 1157426050 18:47585109-47585131 CCTTTGGTCCAGCTCCCTGGTAA No data
Right 1157426059 18:47585148-47585170 CACCCACAGCACCCTGGGTCTGG No data
1157426053_1157426059 1 Left 1157426053 18:47585124-47585146 CCTGGTAAAACACACACCTGTGG No data
Right 1157426059 18:47585148-47585170 CACCCACAGCACCCTGGGTCTGG No data
1157426047_1157426059 26 Left 1157426047 18:47585099-47585121 CCACCTATAGCCTTTGGTCCAGC No data
Right 1157426059 18:47585148-47585170 CACCCACAGCACCCTGGGTCTGG No data
1157426051_1157426059 8 Left 1157426051 18:47585117-47585139 CCAGCTCCCTGGTAAAACACACA No data
Right 1157426059 18:47585148-47585170 CACCCACAGCACCCTGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157426059 Original CRISPR CACCCACAGCACCCTGGGTC TGG Intergenic
No off target data available for this crispr