ID: 1157427591

View in Genome Browser
Species Human (GRCh38)
Location 18:47597263-47597285
Sequence CAAGAATCCATGGGTACCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157427584_1157427591 25 Left 1157427584 18:47597215-47597237 CCCTCTCTTCAGCACACTCCCAT No data
Right 1157427591 18:47597263-47597285 CAAGAATCCATGGGTACCAATGG No data
1157427587_1157427591 6 Left 1157427587 18:47597234-47597256 CCATTCATGACCATATTTCAGCT No data
Right 1157427591 18:47597263-47597285 CAAGAATCCATGGGTACCAATGG No data
1157427586_1157427591 7 Left 1157427586 18:47597233-47597255 CCCATTCATGACCATATTTCAGC No data
Right 1157427591 18:47597263-47597285 CAAGAATCCATGGGTACCAATGG No data
1157427585_1157427591 24 Left 1157427585 18:47597216-47597238 CCTCTCTTCAGCACACTCCCATT No data
Right 1157427591 18:47597263-47597285 CAAGAATCCATGGGTACCAATGG No data
1157427583_1157427591 26 Left 1157427583 18:47597214-47597236 CCCCTCTCTTCAGCACACTCCCA No data
Right 1157427591 18:47597263-47597285 CAAGAATCCATGGGTACCAATGG No data
1157427588_1157427591 -4 Left 1157427588 18:47597244-47597266 CCATATTTCAGCTCACTATCAAG No data
Right 1157427591 18:47597263-47597285 CAAGAATCCATGGGTACCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157427591 Original CRISPR CAAGAATCCATGGGTACCAA TGG Intergenic
No off target data available for this crispr