ID: 1157428360

View in Genome Browser
Species Human (GRCh38)
Location 18:47602812-47602834
Sequence GGTCTCAAGGGCCCAGCAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157428356_1157428360 -10 Left 1157428356 18:47602799-47602821 CCTGTGCACGTTGGGTCTCAAGG No data
Right 1157428360 18:47602812-47602834 GGTCTCAAGGGCCCAGCAGCGGG No data
1157428351_1157428360 14 Left 1157428351 18:47602775-47602797 CCTATGCCTGGCCACAGGGTGCA No data
Right 1157428360 18:47602812-47602834 GGTCTCAAGGGCCCAGCAGCGGG No data
1157428352_1157428360 8 Left 1157428352 18:47602781-47602803 CCTGGCCACAGGGTGCATCCTGT No data
Right 1157428360 18:47602812-47602834 GGTCTCAAGGGCCCAGCAGCGGG No data
1157428353_1157428360 3 Left 1157428353 18:47602786-47602808 CCACAGGGTGCATCCTGTGCACG No data
Right 1157428360 18:47602812-47602834 GGTCTCAAGGGCCCAGCAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157428360 Original CRISPR GGTCTCAAGGGCCCAGCAGC GGG Intergenic
No off target data available for this crispr