ID: 1157429660

View in Genome Browser
Species Human (GRCh38)
Location 18:47614244-47614266
Sequence AGCTGACTGGGGAGTACTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157429660_1157429666 28 Left 1157429660 18:47614244-47614266 CCAAGAGTACTCCCCAGTCAGCT No data
Right 1157429666 18:47614295-47614317 TAGTTCCCCACTCTAAGATGGGG No data
1157429660_1157429665 27 Left 1157429660 18:47614244-47614266 CCAAGAGTACTCCCCAGTCAGCT No data
Right 1157429665 18:47614294-47614316 ATAGTTCCCCACTCTAAGATGGG No data
1157429660_1157429664 26 Left 1157429660 18:47614244-47614266 CCAAGAGTACTCCCCAGTCAGCT No data
Right 1157429664 18:47614293-47614315 TATAGTTCCCCACTCTAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157429660 Original CRISPR AGCTGACTGGGGAGTACTCT TGG (reversed) Intergenic
No off target data available for this crispr