ID: 1157429661

View in Genome Browser
Species Human (GRCh38)
Location 18:47614255-47614277
Sequence CAATGTGCAGAAGCTGACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157429661_1157429664 15 Left 1157429661 18:47614255-47614277 CCCCAGTCAGCTTCTGCACATTG No data
Right 1157429664 18:47614293-47614315 TATAGTTCCCCACTCTAAGATGG No data
1157429661_1157429665 16 Left 1157429661 18:47614255-47614277 CCCCAGTCAGCTTCTGCACATTG No data
Right 1157429665 18:47614294-47614316 ATAGTTCCCCACTCTAAGATGGG No data
1157429661_1157429666 17 Left 1157429661 18:47614255-47614277 CCCCAGTCAGCTTCTGCACATTG No data
Right 1157429666 18:47614295-47614317 TAGTTCCCCACTCTAAGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157429661 Original CRISPR CAATGTGCAGAAGCTGACTG GGG (reversed) Intergenic
No off target data available for this crispr