ID: 1157429666

View in Genome Browser
Species Human (GRCh38)
Location 18:47614295-47614317
Sequence TAGTTCCCCACTCTAAGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157429659_1157429666 29 Left 1157429659 18:47614243-47614265 CCCAAGAGTACTCCCCAGTCAGC No data
Right 1157429666 18:47614295-47614317 TAGTTCCCCACTCTAAGATGGGG No data
1157429660_1157429666 28 Left 1157429660 18:47614244-47614266 CCAAGAGTACTCCCCAGTCAGCT No data
Right 1157429666 18:47614295-47614317 TAGTTCCCCACTCTAAGATGGGG No data
1157429662_1157429666 16 Left 1157429662 18:47614256-47614278 CCCAGTCAGCTTCTGCACATTGC No data
Right 1157429666 18:47614295-47614317 TAGTTCCCCACTCTAAGATGGGG No data
1157429663_1157429666 15 Left 1157429663 18:47614257-47614279 CCAGTCAGCTTCTGCACATTGCT No data
Right 1157429666 18:47614295-47614317 TAGTTCCCCACTCTAAGATGGGG No data
1157429661_1157429666 17 Left 1157429661 18:47614255-47614277 CCCCAGTCAGCTTCTGCACATTG No data
Right 1157429666 18:47614295-47614317 TAGTTCCCCACTCTAAGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157429666 Original CRISPR TAGTTCCCCACTCTAAGATG GGG Intergenic
No off target data available for this crispr