ID: 1157430159

View in Genome Browser
Species Human (GRCh38)
Location 18:47618061-47618083
Sequence CTGGGTTCACTATCGGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157430159_1157430167 23 Left 1157430159 18:47618061-47618083 CCCTCATCCGATAGTGAACCCAG No data
Right 1157430167 18:47618107-47618129 TGACAAAAAGGAAGAGACAAAGG No data
1157430159_1157430166 11 Left 1157430159 18:47618061-47618083 CCCTCATCCGATAGTGAACCCAG No data
Right 1157430166 18:47618095-47618117 TATTCATACTTTTGACAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157430159 Original CRISPR CTGGGTTCACTATCGGATGA GGG (reversed) Intergenic
No off target data available for this crispr