ID: 1157430287

View in Genome Browser
Species Human (GRCh38)
Location 18:47619246-47619268
Sequence ATTTCAACACATAGGTAACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157430287_1157430292 23 Left 1157430287 18:47619246-47619268 CCGTGTTACCTATGTGTTGAAAT No data
Right 1157430292 18:47619292-47619314 AGCCATAGCCAAGAGAAAGGAGG No data
1157430287_1157430291 20 Left 1157430287 18:47619246-47619268 CCGTGTTACCTATGTGTTGAAAT No data
Right 1157430291 18:47619289-47619311 GCAAGCCATAGCCAAGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157430287 Original CRISPR ATTTCAACACATAGGTAACA CGG (reversed) Intergenic
No off target data available for this crispr