ID: 1157434065

View in Genome Browser
Species Human (GRCh38)
Location 18:47653762-47653784
Sequence AAAAAATCAGATGAATTATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157434065_1157434074 28 Left 1157434065 18:47653762-47653784 CCTGATAATTCATCTGATTTTTT No data
Right 1157434074 18:47653813-47653835 TTGGCTGTCCAGATAATTGGGGG No data
1157434065_1157434072 26 Left 1157434065 18:47653762-47653784 CCTGATAATTCATCTGATTTTTT No data
Right 1157434072 18:47653811-47653833 ACTTGGCTGTCCAGATAATTGGG No data
1157434065_1157434071 25 Left 1157434065 18:47653762-47653784 CCTGATAATTCATCTGATTTTTT No data
Right 1157434071 18:47653810-47653832 CACTTGGCTGTCCAGATAATTGG No data
1157434065_1157434067 9 Left 1157434065 18:47653762-47653784 CCTGATAATTCATCTGATTTTTT No data
Right 1157434067 18:47653794-47653816 CAATTTGTCCTCTTCCCACTTGG No data
1157434065_1157434073 27 Left 1157434065 18:47653762-47653784 CCTGATAATTCATCTGATTTTTT No data
Right 1157434073 18:47653812-47653834 CTTGGCTGTCCAGATAATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157434065 Original CRISPR AAAAAATCAGATGAATTATC AGG (reversed) Intergenic