ID: 1157434069

View in Genome Browser
Species Human (GRCh38)
Location 18:47653808-47653830
Sequence AATTATCTGGACAGCCAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157434069_1157434076 -3 Left 1157434069 18:47653808-47653830 CCCACTTGGCTGTCCAGATAATT No data
Right 1157434076 18:47653828-47653850 ATTGGGGGAACCCAAGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157434069 Original CRISPR AATTATCTGGACAGCCAAGT GGG (reversed) Intergenic