ID: 1157434070

View in Genome Browser
Species Human (GRCh38)
Location 18:47653809-47653831
Sequence CAATTATCTGGACAGCCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157434070_1157434076 -4 Left 1157434070 18:47653809-47653831 CCACTTGGCTGTCCAGATAATTG No data
Right 1157434076 18:47653828-47653850 ATTGGGGGAACCCAAGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157434070 Original CRISPR CAATTATCTGGACAGCCAAG TGG (reversed) Intergenic
No off target data available for this crispr