ID: 1157434071

View in Genome Browser
Species Human (GRCh38)
Location 18:47653810-47653832
Sequence CACTTGGCTGTCCAGATAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157434066_1157434071 -1 Left 1157434066 18:47653788-47653810 CCTGAACAATTTGTCCTCTTCCC No data
Right 1157434071 18:47653810-47653832 CACTTGGCTGTCCAGATAATTGG No data
1157434065_1157434071 25 Left 1157434065 18:47653762-47653784 CCTGATAATTCATCTGATTTTTT No data
Right 1157434071 18:47653810-47653832 CACTTGGCTGTCCAGATAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157434071 Original CRISPR CACTTGGCTGTCCAGATAAT TGG Intergenic