ID: 1157434076

View in Genome Browser
Species Human (GRCh38)
Location 18:47653828-47653850
Sequence ATTGGGGGAACCCAAGAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157434070_1157434076 -4 Left 1157434070 18:47653809-47653831 CCACTTGGCTGTCCAGATAATTG No data
Right 1157434076 18:47653828-47653850 ATTGGGGGAACCCAAGAAATTGG No data
1157434069_1157434076 -3 Left 1157434069 18:47653808-47653830 CCCACTTGGCTGTCCAGATAATT No data
Right 1157434076 18:47653828-47653850 ATTGGGGGAACCCAAGAAATTGG No data
1157434066_1157434076 17 Left 1157434066 18:47653788-47653810 CCTGAACAATTTGTCCTCTTCCC No data
Right 1157434076 18:47653828-47653850 ATTGGGGGAACCCAAGAAATTGG No data
1157434068_1157434076 3 Left 1157434068 18:47653802-47653824 CCTCTTCCCACTTGGCTGTCCAG No data
Right 1157434076 18:47653828-47653850 ATTGGGGGAACCCAAGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157434076 Original CRISPR ATTGGGGGAACCCAAGAAAT TGG Intergenic