ID: 1157436343

View in Genome Browser
Species Human (GRCh38)
Location 18:47672668-47672690
Sequence TAATTTGACTAGAGGGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157436331_1157436343 23 Left 1157436331 18:47672622-47672644 CCTGTGCTGATGGAGATGGGGAC No data
Right 1157436343 18:47672668-47672690 TAATTTGACTAGAGGGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157436343 Original CRISPR TAATTTGACTAGAGGGCAGC AGG Intergenic
No off target data available for this crispr