ID: 1157437149

View in Genome Browser
Species Human (GRCh38)
Location 18:47680455-47680477
Sequence GAGCAGAATTTTCAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157437149_1157437155 -5 Left 1157437149 18:47680455-47680477 CCCTCTTCCTGAAAATTCTGCTC No data
Right 1157437155 18:47680473-47680495 TGCTCAGGGCTTAGGCTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157437149 Original CRISPR GAGCAGAATTTTCAGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr