ID: 1157438576

View in Genome Browser
Species Human (GRCh38)
Location 18:47692206-47692228
Sequence GCATGGGAGTTTGCCTTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157438576_1157438583 7 Left 1157438576 18:47692206-47692228 CCCTCAAAGGCAAACTCCCATGC No data
Right 1157438583 18:47692236-47692258 ATTTCTGAGGACTGAAATCCAGG No data
1157438576_1157438582 -6 Left 1157438576 18:47692206-47692228 CCCTCAAAGGCAAACTCCCATGC No data
Right 1157438582 18:47692223-47692245 CCATGCAGAGGGCATTTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157438576 Original CRISPR GCATGGGAGTTTGCCTTTGA GGG (reversed) Intergenic