ID: 1157440508

View in Genome Browser
Species Human (GRCh38)
Location 18:47708030-47708052
Sequence ATATAGATACATATGTAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157440508_1157440513 21 Left 1157440508 18:47708030-47708052 CCTCCCTACATATGTATCTATAT No data
Right 1157440513 18:47708074-47708096 GATAACCCTGCCTAACACAGAGG No data
1157440508_1157440514 22 Left 1157440508 18:47708030-47708052 CCTCCCTACATATGTATCTATAT No data
Right 1157440514 18:47708075-47708097 ATAACCCTGCCTAACACAGAGGG No data
1157440508_1157440511 -1 Left 1157440508 18:47708030-47708052 CCTCCCTACATATGTATCTATAT No data
Right 1157440511 18:47708052-47708074 TCCTATTCATTGTGTTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157440508 Original CRISPR ATATAGATACATATGTAGGG AGG (reversed) Intergenic
No off target data available for this crispr