ID: 1157441952

View in Genome Browser
Species Human (GRCh38)
Location 18:47718398-47718420
Sequence TGGTTCCTTCTGGGGGCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157441939_1157441952 21 Left 1157441939 18:47718354-47718376 CCCCTGTGAGTATTAAGGAGCTA No data
Right 1157441952 18:47718398-47718420 TGGTTCCTTCTGGGGGCATGGGG No data
1157441940_1157441952 20 Left 1157441940 18:47718355-47718377 CCCTGTGAGTATTAAGGAGCTAA No data
Right 1157441952 18:47718398-47718420 TGGTTCCTTCTGGGGGCATGGGG No data
1157441941_1157441952 19 Left 1157441941 18:47718356-47718378 CCTGTGAGTATTAAGGAGCTAAT No data
Right 1157441952 18:47718398-47718420 TGGTTCCTTCTGGGGGCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157441952 Original CRISPR TGGTTCCTTCTGGGGGCATG GGG Intergenic
No off target data available for this crispr