ID: 1157443812

View in Genome Browser
Species Human (GRCh38)
Location 18:47729930-47729952
Sequence GCCTTTCCTGCTCTCTGTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157443804_1157443812 23 Left 1157443804 18:47729884-47729906 CCACCAACAATTAGGCTAAAGGG No data
Right 1157443812 18:47729930-47729952 GCCTTTCCTGCTCTCTGTCGGGG No data
1157443806_1157443812 20 Left 1157443806 18:47729887-47729909 CCAACAATTAGGCTAAAGGGTGA No data
Right 1157443812 18:47729930-47729952 GCCTTTCCTGCTCTCTGTCGGGG No data
1157443808_1157443812 -5 Left 1157443808 18:47729912-47729934 CCATGGCAGAGTCAACCAGCCTT No data
Right 1157443812 18:47729930-47729952 GCCTTTCCTGCTCTCTGTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157443812 Original CRISPR GCCTTTCCTGCTCTCTGTCG GGG Intergenic
No off target data available for this crispr