ID: 1157446335

View in Genome Browser
Species Human (GRCh38)
Location 18:47749265-47749287
Sequence TGAGCTCTGCTGACCCCTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157446328_1157446335 0 Left 1157446328 18:47749242-47749264 CCCGCGCTTCGCGCCCGCGGCCC No data
Right 1157446335 18:47749265-47749287 TGAGCTCTGCTGACCCCTGGCGG No data
1157446327_1157446335 1 Left 1157446327 18:47749241-47749263 CCCCGCGCTTCGCGCCCGCGGCC No data
Right 1157446335 18:47749265-47749287 TGAGCTCTGCTGACCCCTGGCGG No data
1157446322_1157446335 13 Left 1157446322 18:47749229-47749251 CCCAGCCCTGAGCCCCGCGCTTC No data
Right 1157446335 18:47749265-47749287 TGAGCTCTGCTGACCCCTGGCGG No data
1157446324_1157446335 8 Left 1157446324 18:47749234-47749256 CCCTGAGCCCCGCGCTTCGCGCC No data
Right 1157446335 18:47749265-47749287 TGAGCTCTGCTGACCCCTGGCGG No data
1157446329_1157446335 -1 Left 1157446329 18:47749243-47749265 CCGCGCTTCGCGCCCGCGGCCCT No data
Right 1157446335 18:47749265-47749287 TGAGCTCTGCTGACCCCTGGCGG No data
1157446325_1157446335 7 Left 1157446325 18:47749235-47749257 CCTGAGCCCCGCGCTTCGCGCCC No data
Right 1157446335 18:47749265-47749287 TGAGCTCTGCTGACCCCTGGCGG No data
1157446320_1157446335 19 Left 1157446320 18:47749223-47749245 CCGCCGCCCAGCCCTGAGCCCCG No data
Right 1157446335 18:47749265-47749287 TGAGCTCTGCTGACCCCTGGCGG No data
1157446323_1157446335 12 Left 1157446323 18:47749230-47749252 CCAGCCCTGAGCCCCGCGCTTCG No data
Right 1157446335 18:47749265-47749287 TGAGCTCTGCTGACCCCTGGCGG No data
1157446321_1157446335 16 Left 1157446321 18:47749226-47749248 CCGCCCAGCCCTGAGCCCCGCGC No data
Right 1157446335 18:47749265-47749287 TGAGCTCTGCTGACCCCTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157446335 Original CRISPR TGAGCTCTGCTGACCCCTGG CGG Intergenic
No off target data available for this crispr