ID: 1157447510

View in Genome Browser
Species Human (GRCh38)
Location 18:47756327-47756349
Sequence GTGGGCTGGCCAGAAAACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157447510_1157447516 2 Left 1157447510 18:47756327-47756349 CCTCTGTTTTCTGGCCAGCCCAC No data
Right 1157447516 18:47756352-47756374 TTCTAACTGCGGTGCTTCCTGGG No data
1157447510_1157447517 15 Left 1157447510 18:47756327-47756349 CCTCTGTTTTCTGGCCAGCCCAC No data
Right 1157447517 18:47756365-47756387 GCTTCCTGGGATGCAACATTAGG No data
1157447510_1157447515 1 Left 1157447510 18:47756327-47756349 CCTCTGTTTTCTGGCCAGCCCAC No data
Right 1157447515 18:47756351-47756373 TTTCTAACTGCGGTGCTTCCTGG No data
1157447510_1157447512 -9 Left 1157447510 18:47756327-47756349 CCTCTGTTTTCTGGCCAGCCCAC No data
Right 1157447512 18:47756341-47756363 CCAGCCCACTTTTCTAACTGCGG No data
1157447510_1157447520 26 Left 1157447510 18:47756327-47756349 CCTCTGTTTTCTGGCCAGCCCAC No data
Right 1157447520 18:47756376-47756398 TGCAACATTAGGCACCAGTTGGG No data
1157447510_1157447519 25 Left 1157447510 18:47756327-47756349 CCTCTGTTTTCTGGCCAGCCCAC No data
Right 1157447519 18:47756375-47756397 ATGCAACATTAGGCACCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157447510 Original CRISPR GTGGGCTGGCCAGAAAACAG AGG (reversed) Intergenic
No off target data available for this crispr