ID: 1157447512

View in Genome Browser
Species Human (GRCh38)
Location 18:47756341-47756363
Sequence CCAGCCCACTTTTCTAACTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157447509_1157447512 -8 Left 1157447509 18:47756326-47756348 CCCTCTGTTTTCTGGCCAGCCCA No data
Right 1157447512 18:47756341-47756363 CCAGCCCACTTTTCTAACTGCGG No data
1157447503_1157447512 24 Left 1157447503 18:47756294-47756316 CCCACCTCTGTGGGCTGCAGACG No data
Right 1157447512 18:47756341-47756363 CCAGCCCACTTTTCTAACTGCGG No data
1157447502_1157447512 28 Left 1157447502 18:47756290-47756312 CCATCCCACCTCTGTGGGCTGCA No data
Right 1157447512 18:47756341-47756363 CCAGCCCACTTTTCTAACTGCGG No data
1157447504_1157447512 23 Left 1157447504 18:47756295-47756317 CCACCTCTGTGGGCTGCAGACGC No data
Right 1157447512 18:47756341-47756363 CCAGCCCACTTTTCTAACTGCGG No data
1157447510_1157447512 -9 Left 1157447510 18:47756327-47756349 CCTCTGTTTTCTGGCCAGCCCAC No data
Right 1157447512 18:47756341-47756363 CCAGCCCACTTTTCTAACTGCGG No data
1157447505_1157447512 20 Left 1157447505 18:47756298-47756320 CCTCTGTGGGCTGCAGACGCACT No data
Right 1157447512 18:47756341-47756363 CCAGCCCACTTTTCTAACTGCGG No data
1157447508_1157447512 -7 Left 1157447508 18:47756325-47756347 CCCCTCTGTTTTCTGGCCAGCCC No data
Right 1157447512 18:47756341-47756363 CCAGCCCACTTTTCTAACTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157447512 Original CRISPR CCAGCCCACTTTTCTAACTG CGG Intergenic
No off target data available for this crispr