ID: 1157447516

View in Genome Browser
Species Human (GRCh38)
Location 18:47756352-47756374
Sequence TTCTAACTGCGGTGCTTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157447508_1157447516 4 Left 1157447508 18:47756325-47756347 CCCCTCTGTTTTCTGGCCAGCCC No data
Right 1157447516 18:47756352-47756374 TTCTAACTGCGGTGCTTCCTGGG No data
1157447510_1157447516 2 Left 1157447510 18:47756327-47756349 CCTCTGTTTTCTGGCCAGCCCAC No data
Right 1157447516 18:47756352-47756374 TTCTAACTGCGGTGCTTCCTGGG No data
1157447509_1157447516 3 Left 1157447509 18:47756326-47756348 CCCTCTGTTTTCTGGCCAGCCCA No data
Right 1157447516 18:47756352-47756374 TTCTAACTGCGGTGCTTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157447516 Original CRISPR TTCTAACTGCGGTGCTTCCT GGG Intergenic
No off target data available for this crispr