ID: 1157447520

View in Genome Browser
Species Human (GRCh38)
Location 18:47756376-47756398
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157447510_1157447520 26 Left 1157447510 18:47756327-47756349 CCTCTGTTTTCTGGCCAGCCCAC No data
Right 1157447520 18:47756376-47756398 TGCAACATTAGGCACCAGTTGGG No data
1157447509_1157447520 27 Left 1157447509 18:47756326-47756348 CCCTCTGTTTTCTGGCCAGCCCA No data
Right 1157447520 18:47756376-47756398 TGCAACATTAGGCACCAGTTGGG No data
1157447514_1157447520 7 Left 1157447514 18:47756346-47756368 CCACTTTTCTAACTGCGGTGCTT No data
Right 1157447520 18:47756376-47756398 TGCAACATTAGGCACCAGTTGGG No data
1157447513_1157447520 8 Left 1157447513 18:47756345-47756367 CCCACTTTTCTAACTGCGGTGCT No data
Right 1157447520 18:47756376-47756398 TGCAACATTAGGCACCAGTTGGG No data
1157447511_1157447520 12 Left 1157447511 18:47756341-47756363 CCAGCCCACTTTTCTAACTGCGG No data
Right 1157447520 18:47756376-47756398 TGCAACATTAGGCACCAGTTGGG No data
1157447508_1157447520 28 Left 1157447508 18:47756325-47756347 CCCCTCTGTTTTCTGGCCAGCCC No data
Right 1157447520 18:47756376-47756398 TGCAACATTAGGCACCAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157447520 Original CRISPR TGCAACATTAGGCACCAGTT GGG Intergenic
No off target data available for this crispr