ID: 1157448224

View in Genome Browser
Species Human (GRCh38)
Location 18:47764332-47764354
Sequence CAGAGAAAACAGAATGCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157448222_1157448224 28 Left 1157448222 18:47764281-47764303 CCAAATGGCTATTATTAAAAAGT 0: 10
1: 30
2: 56
3: 70
4: 425
Right 1157448224 18:47764332-47764354 CAGAGAAAACAGAATGCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157448224 Original CRISPR CAGAGAAAACAGAATGCTGT TGG Intergenic
No off target data available for this crispr