ID: 1157448948

View in Genome Browser
Species Human (GRCh38)
Location 18:47771422-47771444
Sequence CTGGTCAGAAATAGAATTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157448948_1157448950 -7 Left 1157448948 18:47771422-47771444 CCAACAATTCTATTTCTGACCAG No data
Right 1157448950 18:47771438-47771460 TGACCAGGATACTATGTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157448948 Original CRISPR CTGGTCAGAAATAGAATTGT TGG (reversed) Intergenic
No off target data available for this crispr