ID: 1157452197

View in Genome Browser
Species Human (GRCh38)
Location 18:47797180-47797202
Sequence CCCTGTGGCCTGCTTCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157452186_1157452197 29 Left 1157452186 18:47797128-47797150 CCGTTAGGAAAGAAGAATGAACA No data
Right 1157452197 18:47797180-47797202 CCCTGTGGCCTGCTTCTGGCTGG No data
1157452191_1157452197 -10 Left 1157452191 18:47797167-47797189 CCCGAGAAGCCACCCCTGTGGCC No data
Right 1157452197 18:47797180-47797202 CCCTGTGGCCTGCTTCTGGCTGG No data
1157452190_1157452197 -9 Left 1157452190 18:47797166-47797188 CCCCGAGAAGCCACCCCTGTGGC No data
Right 1157452197 18:47797180-47797202 CCCTGTGGCCTGCTTCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157452197 Original CRISPR CCCTGTGGCCTGCTTCTGGC TGG Intergenic
No off target data available for this crispr