ID: 1157456453

View in Genome Browser
Species Human (GRCh38)
Location 18:47834033-47834055
Sequence AGCTGAAGGTACCAGTATGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 114}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157456453_1157456458 27 Left 1157456453 18:47834033-47834055 CCACCATACTGGTACCTTCAGCT 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1157456458 18:47834083-47834105 CATTCAAAGTACTAAATGACTGG 0: 1
1: 0
2: 1
3: 19
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157456453 Original CRISPR AGCTGAAGGTACCAGTATGG TGG (reversed) Exonic
901359346 1:8683300-8683322 AGATGAAGGAACAAGTCTGGAGG - Intronic
901361084 1:8701255-8701277 AGCTGAAGGCACCGGGATGGGGG + Intronic
904059989 1:27701407-27701429 AGCTGAAGGTAGAAGTCTAGGGG + Intergenic
906275936 1:44515647-44515669 AACTGAGGGTGCCAGTATAGGGG + Intronic
910922518 1:92364446-92364468 AGCTGAAGATACCATTTTGGGGG - Intronic
911209022 1:95120136-95120158 AGAAGAAGATAGCAGTATGGAGG + Intronic
911684798 1:100763531-100763553 AACTGAAGGCACCAGTATATAGG + Intergenic
912181935 1:107229596-107229618 AGATGGAGGTACCAGTGTGTTGG + Intronic
914460269 1:147877435-147877457 ACCTGAAGGTGCCAGGAGGGTGG - Intergenic
919675315 1:200376503-200376525 AGCTGAGTGTTCCAATATGGTGG - Intergenic
921829373 1:219710306-219710328 AGCTGAAGGGAGCTGTCTGGTGG - Intronic
922425149 1:225485416-225485438 AGCTGCAGACACTAGTATGGAGG - Intergenic
1069205733 10:65682520-65682542 AGCTGAAGATACAAATATGAGGG + Intergenic
1072960698 10:99926624-99926646 AGCCAAAGGTTCCAGTCTGGGGG + Intronic
1073577277 10:104637622-104637644 ATTTGAAGGTGCCAGTGTGGAGG + Intergenic
1074886628 10:117699189-117699211 ATCTGAAGGCATCAGGATGGAGG + Intergenic
1076248233 10:128964233-128964255 AGCGGAAGGTTCCAGACTGGAGG - Intergenic
1084655663 11:70515960-70515982 AACTGAAGAAACCAGTATGCAGG - Intronic
1090887447 11:130891648-130891670 AGAGGAAGGTAGCAGAATGGGGG + Intronic
1098015907 12:66104395-66104417 AGCAGAAGCTGCCAGAATGGAGG - Intergenic
1098328181 12:69324305-69324327 AACTGAAGGTCCAGGTATGGTGG + Intergenic
1100773321 12:97948006-97948028 AGCTGAAGGCAGCAGTAGAGGGG + Intergenic
1101071017 12:101076174-101076196 AGGTGAAGGTATTAGTAAGGGGG + Intronic
1101163854 12:102007740-102007762 AGCTGATGTTATCAGTATAGAGG - Intronic
1102727264 12:115076703-115076725 TGCTGATGGTGCCAGTCTGGGGG + Intergenic
1104271000 12:127282194-127282216 AGCTGAAGGTACAAGTTTGAAGG - Intergenic
1108754587 13:53484684-53484706 AGCCGAAGGTCCCTGTTTGGTGG - Intergenic
1113449051 13:110393098-110393120 TGCTGAAGGCAACAGTATGGAGG + Intronic
1114157026 14:20116442-20116464 GCCTGAAGGCTCCAGTATGGGGG + Intergenic
1121427512 14:93863084-93863106 AGCTGAAGGTACCAGGGAGCAGG + Intergenic
1122070686 14:99203785-99203807 AGCTGAAGGTCCCACTGTGCTGG - Intronic
1122223452 14:100257680-100257702 AGATCAAGGTGCCAGCATGGTGG - Intronic
1131019811 15:89088509-89088531 AGCTGCAGGAACCAGACTGGGGG + Exonic
1131249842 15:90823078-90823100 AGCTTAAGGTCCCAGTCTAGGGG - Intergenic
1139548870 16:67662539-67662561 AGCTGCGGGTACCAGGATGTCGG - Exonic
1141648628 16:85380522-85380544 AGCTGGGGGTACCAGGGTGGCGG - Intergenic
1143524206 17:7462926-7462948 TGCTGGAGGTGCCAGTGTGGGGG - Exonic
1143661407 17:8326802-8326824 AGCTGAACCTGCGAGTATGGAGG - Intergenic
1146477221 17:33172736-33172758 TGCTGAGGCTACCAGTCTGGGGG - Intronic
1146734376 17:35225117-35225139 TGCTGAAACTACCAGGATGGTGG - Intergenic
1148944869 17:51252331-51252353 AGCTGACAGAACCAGTATTGGGG - Intronic
1149337012 17:55645653-55645675 AGTTGAAGGTACAAGTAAGAAGG + Intergenic
1149777397 17:59368955-59368977 AGCTGAAGGCACCACCAAGGAGG - Intronic
1152878311 17:82800975-82800997 AGCCGAAGGTGGCAGCATGGAGG + Exonic
1154000302 18:10477017-10477039 AGCTGCAGGAGCCAGCATGGAGG + Intronic
1154000514 18:10478474-10478496 AGATCAAGGCACCAGCATGGTGG + Intronic
1156108369 18:33692946-33692968 AGATAAAGGTGCCAGCATGGTGG + Intronic
1157456453 18:47834033-47834055 AGCTGAAGGTACCAGTATGGTGG - Exonic
1158382366 18:56946590-56946612 AGCTGAAGGTATGATTATGAGGG - Intronic
1159224777 18:65519462-65519484 TGATGAACGTATCAGTATGGTGG + Intergenic
1164122959 19:22284683-22284705 AGCTGAAGATACATGTCTGGAGG + Intergenic
1164177223 19:22785850-22785872 AGCTGAAGATACATGTCTGGAGG - Intergenic
1167504396 19:49863406-49863428 AGCTGAAGGTATCAGTGAGCGGG - Intronic
926039017 2:9657828-9657850 AGCTGTAGGCTCCAGAATGGGGG + Intergenic
929698360 2:44139841-44139863 AGATGAAAGTACCAGGAAGGTGG + Intergenic
936767424 2:115870275-115870297 AGCAGAAGTTACAACTATGGGGG + Intergenic
941955205 2:171196722-171196744 ATCTGAAGGCAGCAGTCTGGAGG + Intronic
942772498 2:179539155-179539177 AGATCAAGGTGCCAGTATGGTGG + Intronic
945146474 2:206743505-206743527 AAATGAAGCTATCAGTATGGTGG - Intronic
946486411 2:220104914-220104936 AGCTGAAGGTTCTGGGATGGTGG - Intergenic
949031615 2:241799829-241799851 AGCAGAAGTGACCAGGATGGTGG - Intronic
1171022602 20:21600043-21600065 AGCTGAAATTATCAGAATGGTGG + Intergenic
1171144974 20:22773840-22773862 ATCTGAAGAACCCAGTATGGGGG + Intergenic
1172572578 20:35982141-35982163 AGCAGAAGGTGGCAGTGTGGAGG + Intronic
1172673041 20:36647500-36647522 AGCTGAAGGAGCCAGAGTGGAGG + Intergenic
1178507705 21:33176483-33176505 AGCTGAAGGTCCCAGAAGGATGG - Intergenic
1178807611 21:35852335-35852357 AGATCAAGGTGCCAGTAGGGTGG - Intronic
1183220776 22:36511551-36511573 AGCTGAAGGTGCCATCAGGGAGG + Exonic
950667214 3:14504972-14504994 AGCTGTGGGTACCAGGAGGGAGG + Intronic
951345100 3:21538267-21538289 AGCTGGAGATACAAATATGGGGG + Intronic
953941399 3:47101496-47101518 GCCTGAAGGAACCAGTTTGGTGG + Exonic
954821112 3:53328221-53328243 ACCTGAAGGGCCCAGTCTGGAGG + Intronic
954830887 3:53420457-53420479 AGGCCAAGGTACCAGTGTGGTGG + Intergenic
955005144 3:54961676-54961698 AGCTGATGGCACCAGTATCATGG + Intronic
955948935 3:64222649-64222671 AGCTGAAGGCACCCAGATGGTGG + Intronic
960150207 3:114241653-114241675 AGCAGAAGGGAGCTGTATGGAGG - Intergenic
971145976 4:23976781-23976803 AGCTCAAGGTGCCAGCAGGGTGG - Intergenic
972120227 4:35692731-35692753 AGCTTGAGGTACCATTATGTGGG + Intergenic
977917843 4:102613623-102613645 AGCTGAAGACACCAGCCTGGGGG - Intronic
984246574 4:177282023-177282045 AGCTTAAGGTATCTGTCTGGAGG - Intergenic
985673147 5:1216700-1216722 AGCCCAAGGCACCAGGATGGTGG - Intronic
986275000 5:6266215-6266237 AGCTGGAGGTATCAGTATTGAGG + Intergenic
988625413 5:32869736-32869758 AGTTTGAGGTACCAGTATGACGG + Intergenic
989786450 5:45337106-45337128 AGAGGAAGGTACCATTATAGAGG - Intronic
990295429 5:54397047-54397069 GGCTGAAGGTACCACTGGGGAGG - Intergenic
990351615 5:54922761-54922783 AGATGAAGGGAACAGAATGGAGG + Intergenic
990497897 5:56367182-56367204 AGATGAGGGTGCCAGCATGGTGG + Intergenic
990557719 5:56952096-56952118 CCCTAAAGGTACCAATATGGCGG - Exonic
993884343 5:93398391-93398413 AGCAGAAGGTACCTGTGGGGAGG + Intergenic
995140095 5:108726652-108726674 ATCTGATGGTAACAGGATGGAGG - Intergenic
996781089 5:127187266-127187288 AGCTGAAGATGACAGGATGGGGG + Intergenic
996922615 5:128786681-128786703 AGATGAAGGTGCCAGTTTGAAGG + Intronic
997995451 5:138582178-138582200 AGATGAGGGTGCCAGCATGGTGG - Intergenic
998300185 5:141010447-141010469 AGCGGAAGTTATCAGTATGGAGG + Exonic
999238434 5:150113735-150113757 AGCTGAAGGGACCTGTCTGGGGG + Intergenic
1001437584 5:171712253-171712275 AGATTAAGGTAGCAGGATGGGGG - Intergenic
1001739552 5:174040705-174040727 GGCTAAAGGGACCAATATGGTGG - Intergenic
1001888155 5:175314683-175314705 AGCTGAAGGTGCAAGAATGAAGG - Intergenic
1002480229 5:179496280-179496302 AGAGGAAGGGACCAGGATGGAGG - Intergenic
1003253350 6:4452586-4452608 AGCTGATTTTACCATTATGGTGG - Intergenic
1004336636 6:14770214-14770236 AGATCAAGGTGCCAGCATGGTGG - Intergenic
1004526202 6:16410339-16410361 TGCTGAAGGGACCCCTATGGAGG + Intronic
1005703540 6:28428815-28428837 AGCTGAAGAGATCAGTATGCTGG - Intergenic
1009562684 6:65269679-65269701 AGATGAGGGTGCCAGGATGGTGG + Intronic
1012323681 6:97885942-97885964 AGCTGAAGGTGCAAATATAGAGG - Intergenic
1021412862 7:20347754-20347776 AACTGAAGGTACCAATTTGGTGG + Intronic
1022786198 7:33639930-33639952 AGCTGGTGGTGCCATTATGGCGG - Intergenic
1025926359 7:65963421-65963443 AACTGAAGATAGCAGTTTGGTGG - Intronic
1029304466 7:99608506-99608528 AGCCTAAGGAACCAGGATGGTGG - Intergenic
1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG + Intronic
1035387982 7:158487344-158487366 TGCTGAGGGAAACAGTATGGTGG - Intronic
1044950590 8:97432054-97432076 AGCTGGAGGTACCACTAGGTGGG + Intergenic
1048956455 8:139541137-139541159 AGATGAAGGTGGCAGGATGGGGG - Intergenic
1056257338 9:84813613-84813635 AGCTGAGGGTCACAGCATGGTGG - Intronic
1056275647 9:84991878-84991900 GTCTGAAGGTACCTGTCTGGAGG + Intronic
1057242597 9:93424741-93424763 TGCTGAAGGAAACAGTTTGGTGG - Intergenic
1057953998 9:99392899-99392921 AGGTAAAGGGACCAGTATGAGGG - Intergenic
1186475551 X:9854459-9854481 TGCTGAAGGCACCTGGATGGGGG + Intronic
1188582148 X:31727319-31727341 CCCTCAAGGTTCCAGTATGGTGG + Intronic
1192167627 X:68835603-68835625 TGCTAAGGTTACCAGTATGGGGG + Intronic
1192633247 X:72792810-72792832 AGCTGAGAGCACCAGTCTGGGGG + Intronic
1192648462 X:72927991-72928013 AGCTGAGAGCACCAGTCTGGGGG - Intronic
1197807382 X:130410753-130410775 AGCTGATTGTTCCAGTATGGTGG + Intronic
1198759239 X:140013975-140013997 GGTTGAAAGTACCAGGATGGAGG + Intergenic
1198779500 X:140219602-140219624 GGTTGAAAGTACCAGGATGGAGG - Intergenic