ID: 1157457182

View in Genome Browser
Species Human (GRCh38)
Location 18:47842959-47842981
Sequence TGGGCTTTTCTCATATTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 332}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157457182 Original CRISPR TGGGCTTTTCTCATATTTGA AGG (reversed) Intronic
901389976 1:8938659-8938681 TGGGCTTTGCTCAAATGGGAGGG - Intergenic
901390127 1:8940065-8940087 TGGGCTTTGCTCAAATGGGAGGG - Intergenic
903045899 1:20563941-20563963 TGTGCTTTTATCATCTTAGAAGG - Intergenic
903676287 1:25066636-25066658 GGGGGTTTGCTCTTATTTGATGG + Intergenic
906687834 1:47773841-47773863 TGGGCTTGACTCTTATTTGCTGG + Intronic
908612486 1:65878114-65878136 TGAGCTTTTTTCATGTTTGTTGG - Intronic
908780858 1:67688141-67688163 TCGGCTTTTCTTTTACTTGAGGG - Exonic
908840208 1:68272594-68272616 ATGGCTTTTCACATATTAGAAGG + Intergenic
909165340 1:72215592-72215614 TGAGCTTTTTTCACATTTGTTGG - Intronic
909766591 1:79363971-79363993 TTTTCATTTCTCATATTTGAAGG + Intergenic
910304274 1:85743702-85743724 TGATTTTTTCCCATATTTGAGGG - Intronic
910474221 1:87589593-87589615 TGTGATATTCTAATATTTGAAGG - Intergenic
911496632 1:98638697-98638719 AAGGCTTTTCAGATATTTGAAGG - Intergenic
911712479 1:101090061-101090083 TAGGCTTTTCTCTGTTTTGATGG + Intergenic
915512882 1:156396255-156396277 TGGGCTCCCCTCAGATTTGAGGG - Intergenic
917887151 1:179398095-179398117 TGTTTTTTTCTCATATTTGTGGG + Intronic
918504472 1:185236941-185236963 TGAGCTTTTTTCATGTTTGTTGG - Intronic
918746447 1:188207434-188207456 TGTGCTTTTTTCATAGTTGTTGG - Intergenic
918806992 1:189060767-189060789 TGAGCTTTTTTCATGTTTGTTGG - Intergenic
918945732 1:191061945-191061967 TGGTCTTTTCACATATTTCTTGG + Intergenic
918992110 1:191710142-191710164 TTGGCTCTTCTCATATTAGTTGG + Intergenic
919583339 1:199405176-199405198 TGTGTTTTTCCCATATGTGAAGG + Intergenic
921800590 1:219398659-219398681 TGGTCCTTTCTCATCTTTAAGGG + Intergenic
923343988 1:233033639-233033661 TGGGCTGTTTTAATATTTCACGG + Intronic
1063343307 10:5288997-5289019 TGAGCATTTTTCATATTTGTTGG - Intergenic
1063738077 10:8784624-8784646 TGTGCATTTCTAATATTTGTAGG + Intergenic
1064117521 10:12591557-12591579 TCGGCTTTTCTCATTTTGGTGGG + Intronic
1064525981 10:16257260-16257282 TGCCCTTTTCTCCTACTTGAGGG + Intergenic
1066018689 10:31274596-31274618 TCTTCTTTTCTCATAGTTGAAGG - Intergenic
1067258895 10:44668245-44668267 TGGGCTTTTCTCTGAGTTGAGGG - Intergenic
1067461156 10:46459707-46459729 TGGGCTTTTCACAAAATAGATGG + Intergenic
1067626038 10:47924894-47924916 TGGGCTTTTCACAAAATAGATGG - Intergenic
1068325593 10:55482089-55482111 TTGGCTTTTTTGATCTTTGATGG + Intronic
1068551919 10:58416323-58416345 TGGGATTTTATCAGATTTGGAGG - Intergenic
1070445880 10:76501678-76501700 TGTCCTTTTCCCATTTTTGATGG + Intronic
1070709275 10:78666651-78666673 TGAGCTTTTTTCATGTTTGTTGG - Intergenic
1071031675 10:81192223-81192245 TGGACTTTTCGCTTAGTTGATGG + Intergenic
1071552534 10:86577989-86578011 TTGACTTTTCACATTTTTGATGG + Intergenic
1071872930 10:89815182-89815204 TTGGCTTTTCTGATATGTGGAGG + Intergenic
1072840726 10:98771313-98771335 TGGGCCTATCTCATATTTCAGGG - Intronic
1073439244 10:103543014-103543036 TGGGCTTTTTTCTTCTTGGAAGG + Intronic
1074855272 10:117468744-117468766 TGGGCTACTCTGATATTTGGTGG + Intergenic
1075164202 10:120052316-120052338 TGGGCTTTGCTCAGAAGTGAGGG + Intergenic
1075881951 10:125860617-125860639 TGGGCTTTTCCCATACTTCTTGG + Intronic
1079276728 11:19045347-19045369 TGAGCTTTTTTCATGTTTGTTGG - Intergenic
1079606574 11:22376015-22376037 TTGGCTATTCTCATACTAGAGGG + Exonic
1079911634 11:26317491-26317513 TGAGCTTTTTTCATGTTTGTTGG - Intronic
1081316936 11:41641487-41641509 TGGGTCTTTCTCATATGTGTGGG + Intergenic
1082747332 11:56979384-56979406 TGGCCTTTTCTCATATGAGCTGG - Intergenic
1083006381 11:59350713-59350735 TGGTCCTTTCTCATCTTTGTGGG + Intergenic
1083076070 11:60040080-60040102 TAGGCTGTTCTCATATTAGATGG + Intergenic
1083862036 11:65425588-65425610 TGGGCTTTTAACGTATTTAAGGG + Intergenic
1086209458 11:84301262-84301284 TGAGCTTTTTTCATGTTTGTTGG - Intronic
1086279488 11:85170029-85170051 TGTGCTTTTCTCCTATTTTTAGG - Intronic
1088299608 11:108342592-108342614 TAGGATTTTCTCACATTTGCTGG - Intronic
1088675641 11:112189820-112189842 TGGGACTATCTCACATTTGAAGG - Intronic
1088868520 11:113871876-113871898 TGGTCCTATCTCATAGTTGATGG - Intronic
1090689352 11:129161531-129161553 TGAGCTTTTTTCATGTTTGTTGG - Intronic
1090899254 11:131012452-131012474 TGGCCTTCTCTCATAATGGATGG + Intergenic
1093111243 12:15154853-15154875 GGGTCTTTCCTAATATTTGATGG + Intronic
1093315085 12:17639446-17639468 TGGGCTTTTCAGGTATTTGGGGG - Intergenic
1093490848 12:19701824-19701846 TGGTTCTTTCTCATATTTGTGGG - Intronic
1094157168 12:27349370-27349392 TGTGCTTGTCTCATTATTGATGG + Intronic
1095779286 12:46041306-46041328 TGAGCTTTTTTCATGTTTGTTGG - Intergenic
1096056275 12:48655060-48655082 TGGGCTTTTCTCTTTTTTCTAGG - Exonic
1096589893 12:52651035-52651057 CTGGCTTTTCTCCTATTTCAAGG - Intronic
1097524053 12:60707991-60708013 TGAGCTTTTTTCATGTTTGTCGG + Intergenic
1097634089 12:62101175-62101197 GGAGCTGTTCTTATATTTGAGGG - Intronic
1097719556 12:63005140-63005162 TGAGCTTTTTTCATGTTTGTTGG - Intergenic
1097787924 12:63781101-63781123 TGGATTTATCTAATATTTGAAGG - Exonic
1098102665 12:67035031-67035053 GATGCTTTTCACATATTTGAAGG - Intergenic
1098211828 12:68174506-68174528 TGAGCTTTTTTCATGTTTGTTGG - Intergenic
1099750980 12:86772230-86772252 TGGACTGTCCTCATGTTTGATGG + Intronic
1100061257 12:90578682-90578704 TGAGCATTTTTCATATTTGTTGG - Intergenic
1101197919 12:102404664-102404686 TGGTCTTTTGTGATATTTGAGGG - Intronic
1101472183 12:105008247-105008269 TGAGCTTTTTTCATGTTTGTTGG + Intronic
1101980172 12:109399216-109399238 TGGGCTATCCTCATGTTTTACGG - Intronic
1103576245 12:121879515-121879537 TTTTCTTTTCTCTTATTTGATGG + Intergenic
1106074566 13:26446911-26446933 TGAGCTTTTCTCCTGGTTGATGG + Intergenic
1106726944 13:32495872-32495894 TGGGGTTTCCTCATATTGGTAGG + Intronic
1108382828 13:49870626-49870648 TAGGCTTTTCTTGTTTTTGATGG - Intergenic
1108895257 13:55318914-55318936 TGAGCTTTTTTCATATTTGTTGG + Intergenic
1109117506 13:58407226-58407248 TTGACTTTTATCATATTGGAAGG - Intergenic
1109911818 13:68922749-68922771 TGTGCTTTTCTCCTATTATAAGG - Intergenic
1114134854 14:19835493-19835515 TGGTTTTTTCTCATTTTTGTGGG - Intergenic
1114480653 14:23032093-23032115 TGGGCTCCTCTCTTTTTTGAGGG - Intronic
1114609716 14:24031084-24031106 TGAGCTTTTTTCATTTTTGTTGG - Intergenic
1115167935 14:30470795-30470817 TTGACTTCTCTCATATTTAATGG - Intergenic
1115907596 14:38217892-38217914 TGGGTTTTTGTCACATTTGAAGG - Intergenic
1116395391 14:44442619-44442641 TGAGGTTTGCTGATATTTGAGGG - Intergenic
1116498605 14:45593035-45593057 TGAGCTTTTTTCATGTTTGTTGG - Intergenic
1117018033 14:51539059-51539081 TGGGCTTTTTCTATTTTTGATGG + Intronic
1117525005 14:56591987-56592009 TGTGCTTTTTTCCTTTTTGAAGG + Intronic
1117829767 14:59739051-59739073 TGGGCTTAACTCCTATGTGATGG + Intronic
1118004989 14:61557660-61557682 TTAGCTTTTCACATATTTGAAGG - Intronic
1118200395 14:63666227-63666249 TGGGATTTTCTTGTTTTTGAGGG - Intergenic
1118635500 14:67745171-67745193 TGAGCTTTTTTCATGTTTGTTGG + Intronic
1118652786 14:67915490-67915512 TTGGCTTTTATCATCTTTGCTGG + Intronic
1120867996 14:89311981-89312003 TGGCCTTCACTCATTTTTGATGG - Intronic
1121143424 14:91562259-91562281 TGAGCTTTTTTCATGTTTGTTGG - Intergenic
1123434244 15:20243497-20243519 TGGGGTTTCCTGATATTTAAGGG + Intergenic
1123959047 15:25375051-25375073 TGGGTTTTTTCCATTTTTGAAGG - Intronic
1126277996 15:46907281-46907303 TGAGCTTTTTTCATGTTTGTTGG + Intergenic
1126596033 15:50385052-50385074 TGGGTTTTTTTCTTTTTTGATGG - Intergenic
1127041505 15:54982074-54982096 TGGGTTGTTCTCAAACTTGAAGG + Intergenic
1131103382 15:89712500-89712522 TGGCCTTTCCTCATTTTTCAAGG + Intronic
1131812194 15:96184191-96184213 TGGGGTTTTCTTATATTTTTCGG - Intergenic
1132713834 16:1280755-1280777 TGGCTTTTTCTCCTATTTGTTGG - Intergenic
1133987290 16:10678066-10678088 TGGGGTTTTCTCATCTGGGAAGG + Intronic
1134327973 16:13224472-13224494 TGCCCATTTCTCATATTTCAGGG + Intronic
1134787415 16:16957344-16957366 TGTGCTTCTCTTATATTTTAAGG + Intergenic
1135531901 16:23262039-23262061 TGGTCTTTTAAAATATTTGAGGG - Intergenic
1136573835 16:31111825-31111847 TGGGCTTGGCTCAGCTTTGATGG - Intronic
1136850368 16:33607614-33607636 TGGGGTTTCCTGATATTTAAGGG - Intergenic
1137330014 16:47484262-47484284 TGGGCTTTTCACATATTATTTGG + Intronic
1139356152 16:66368104-66368126 TGGACGTTTCTCATGTGTGATGG + Intronic
1139787124 16:69402799-69402821 TGGGCGTTTCTCATATCTCGAGG + Intronic
1140284130 16:73584962-73584984 TGAGCTTTTTTCATGTTTGTTGG - Intergenic
1140789314 16:78375402-78375424 TGGCTTTTCCCCATATTTGATGG + Intronic
1141102134 16:81205564-81205586 TGTGCTTTTCTCTTATGTGTTGG - Intergenic
1203111981 16_KI270728v1_random:1456067-1456089 TGGGGTTTCCTGATATTTAAGGG - Intergenic
1149230957 17:54533326-54533348 TGAGCTTTTTTCATGTTTGTTGG + Intergenic
1149246933 17:54720295-54720317 TGAGCTTTTTTCATGTTTGTTGG - Intergenic
1150993050 17:70283039-70283061 TGAGCTTTTCTCTAATCTGACGG + Intergenic
1153815791 18:8788949-8788971 TGTGATTGTCTCACATTTGATGG - Intronic
1154019317 18:10648627-10648649 TGGTGTTTTCTCATCTTTGTGGG - Intergenic
1154076865 18:11211839-11211861 AGGGCTTTTCTCCTTTTAGATGG + Intergenic
1154184899 18:12174605-12174627 TGGTGTTTTCTCATCTTTGTGGG + Intergenic
1155037904 18:22040781-22040803 TGGCTTTTTCTCCTATATGATGG + Intergenic
1155847532 18:30728299-30728321 TGGTGTTTTCTTATTTTTGAGGG - Intergenic
1156878125 18:42041430-42041452 TCACCTTTTCTCATATTTAAAGG - Intronic
1157457182 18:47842959-47842981 TGGGCTTTTCTCATATTTGAAGG - Intronic
1159243421 18:65773889-65773911 TTGGCTATTCAAATATTTGAAGG + Intronic
1159483754 18:69026617-69026639 TGGGCTTTTCTCTGACTTCAGGG - Intronic
1159967847 18:74613904-74613926 TGGGCTTTGGTTACATTTGATGG - Intronic
1160399833 18:78602072-78602094 TGGGCTTGTCTCATCTCTGCAGG + Intergenic
1160442880 18:78905749-78905771 GGAGCTTTTATGATATTTGATGG + Intergenic
1162180712 19:8867031-8867053 TGGGCTTTTGTCCTCTCTGATGG - Intronic
1164128646 19:22341598-22341620 TGGGCTTTTCTTATGTGTGAGGG - Intergenic
1164170832 19:22723736-22723758 TGGGCTCTTCTTATGTGTGAGGG + Intergenic
1165657984 19:37550398-37550420 TGGTGTTTTCTCATTGTTGAGGG + Intergenic
925913281 2:8587091-8587113 GGGGCTGTTTTCAGATTTGAAGG - Intergenic
926273930 2:11389033-11389055 TGGGCTTTTCTCATTGATTATGG + Intergenic
927038426 2:19204246-19204268 TGGGCTGTTCTCAGATGTGAAGG - Intergenic
927042123 2:19240329-19240351 TGGGGTTTGCTCAGATGTGAGGG - Intergenic
927210882 2:20638345-20638367 AGGGCTTTTCTCAGATTCCAGGG + Intronic
928061015 2:28112962-28112984 TGAGCTTTTTTCATGTTTGTTGG + Intronic
928501293 2:31898975-31898997 TTGTCTTTTCTCATATTTGTTGG + Intronic
929095575 2:38260560-38260582 TGGGCTTCTCTCACATTAGAGGG + Intergenic
929704757 2:44198618-44198640 TACGCTTTTATCTTATTTGAGGG - Intronic
929740562 2:44595035-44595057 TGAGCTTTTTTCATGTTTGCTGG - Intronic
930359209 2:50357625-50357647 TGTGCTATTCTCATATTGAAGGG + Intronic
930460006 2:51661837-51661859 TGTGGTTTTCTCAAATGTGAAGG + Intergenic
930598958 2:53422457-53422479 GTGGCTTTTGTCATATTTGATGG - Intergenic
930797236 2:55406283-55406305 GTGAGTTTTCTCATATTTGAAGG - Intronic
930887942 2:56349575-56349597 AGAGATTTCCTCATATTTGAGGG + Intronic
930935194 2:56940486-56940508 TGGGCTTTTCTAATTTTTCAAGG + Intergenic
930939183 2:56993607-56993629 TAGGCTTTTCTAGTATATGAAGG + Intergenic
932151252 2:69373859-69373881 TTGTCTTTTATCATATTTAAAGG - Intronic
934996515 2:98966747-98966769 TGGTTCTTTCTCATCTTTGAGGG + Intergenic
935135359 2:100295721-100295743 TGGCCTTTTCTCACAGTGGAGGG - Intronic
936709337 2:115113673-115113695 TGGACTTTTCACATAGATGAAGG - Intronic
936718840 2:115224223-115224245 TGGGCTTTCCTGAAATCTGAAGG + Intronic
937808038 2:126168780-126168802 TGAGTTTTTCTCATGTTTGTTGG - Intergenic
938567874 2:132536831-132536853 TGGTCTTTTTTCATCTTTGTTGG + Intronic
941127212 2:161598696-161598718 TGTCCTTTGCTCATTTTTGATGG - Intronic
942893950 2:181027586-181027608 TGTGCTTTTTTTAAATTTGAAGG + Intronic
943312767 2:186347236-186347258 TGGGCTTTTCTCATCATGTAAGG + Intergenic
943626177 2:190202584-190202606 TGGGCTTTACTTCAATTTGAAGG + Exonic
946680338 2:222208066-222208088 TGGGCTTTACTGATAATAGATGG - Intronic
947258553 2:228193512-228193534 TGGGCTTTTTTTATTTTTAAAGG + Intergenic
948332909 2:237184131-237184153 TTTACTTTTCTCATATTTGAGGG - Intergenic
948436906 2:237960045-237960067 GTGGCTTCTCTCACATTTGATGG + Intergenic
1171434307 20:25107621-25107643 TTGTCTTTTCTGATATTTGTTGG - Intergenic
1172900788 20:38333088-38333110 TGGATTTTTATCAGATTTGAAGG - Intronic
1173063002 20:39680104-39680126 GGGGCTTTTCTCCTTTTTGCTGG - Intergenic
1174310787 20:49652333-49652355 TGGTCTTTTCTCAAATGGGAGGG - Intronic
1175759569 20:61552171-61552193 TGGCCTTTTCACTTTTTTGATGG - Intronic
1177340271 21:19789701-19789723 TTATCTTTTATCATATTTGAGGG + Intergenic
1177705561 21:24699535-24699557 TGAGCTTTTTTCATGTTTGTTGG + Intergenic
1179587770 21:42384533-42384555 TGTGCTTTTCTCATAGTGAAGGG + Intronic
1185379939 22:50503688-50503710 TGGGCTTTTCTCCTGTGGGAGGG + Exonic
949192064 3:1262005-1262027 TGGGTTTTTCATTTATTTGAAGG - Intronic
949322141 3:2823522-2823544 TGGTGTTTTCTTATATTTAATGG - Intronic
949680184 3:6504737-6504759 TCAGCTTTTCTCATTTTTCATGG - Intergenic
949953254 3:9247035-9247057 TGTGCTTATCTCATTTTGGAAGG - Intronic
950857198 3:16116625-16116647 TAGACAGTTCTCATATTTGATGG - Intergenic
951615381 3:24537691-24537713 TGGACTTATCTGATCTTTGAAGG + Intergenic
951635051 3:24764683-24764705 TGGGATCTTCTTAAATTTGAAGG + Intergenic
952238777 3:31508170-31508192 TGGGCTCTCCTCATCTGTGATGG + Intergenic
952549013 3:34454870-34454892 TGAGTTTTTTTCATGTTTGATGG + Intergenic
952616835 3:35283631-35283653 TGAGCTTTTTTCATGTTTGTTGG - Intergenic
952683542 3:36123230-36123252 TGAGCTTTTTTCATGTTTGTTGG - Intergenic
952805956 3:37352335-37352357 TGGGCTTTTCTCCCTTTTGCTGG - Intronic
953586488 3:44205922-44205944 TGGGCTATTGGCATATTTCATGG - Intergenic
955432264 3:58859331-58859353 TAGGCTTTTCTAATTTTTCAAGG + Intronic
955968937 3:64417741-64417763 TTGTCTTCTTTCATATTTGAGGG + Intronic
957013362 3:75033645-75033667 TGTCTTTTTCTCATTTTTGATGG - Intergenic
959165290 3:102769277-102769299 TGAGCTTTTTTCATGTTTGTTGG + Intergenic
959250109 3:103930945-103930967 TGAGCTTTTTTCATGTTTGTTGG + Intergenic
959307103 3:104681427-104681449 TGGTCTTTTCACTTTTTTGATGG - Intergenic
959770108 3:110084372-110084394 AGTGGTTTTCACATATTTGAGGG + Intergenic
960356147 3:116655895-116655917 TGGGCTGTTCACTTATTTCAGGG - Intronic
960688195 3:120314604-120314626 TGGTTTTTTCTTATATTTGTGGG - Intergenic
961920949 3:130425733-130425755 TGGGCCTTTCTCATATGTAGAGG + Intronic
962001604 3:131304502-131304524 TGGTTCTTTCTCATATTTGTGGG + Intronic
962176582 3:133161696-133161718 TGGGCTTTTTTTTTTTTTGAGGG - Intronic
964168480 3:153737836-153737858 TGAGCTTTTTTCATGTTTGTTGG - Intergenic
965200934 3:165656630-165656652 TGGTCTTTTCACATATTTCTTGG - Intergenic
965984262 3:174732990-174733012 TGGTATATTCTCATATTAGAAGG - Intronic
969093482 4:4714794-4714816 TCTGCTCTTCTCAGATTTGAGGG - Intergenic
972061359 4:34877665-34877687 TGAGCTTTTTTCATGTTTGTTGG - Intergenic
973213662 4:47644475-47644497 TGGGCTTTTCTGTTATTTGTAGG + Intronic
973652670 4:53012169-53012191 TGGGCTTTTCTCATTGTTGATGG - Intronic
974003384 4:56532336-56532358 CTGCCTTTTCTCATATTTCAGGG + Intronic
974240255 4:59237577-59237599 TGGTTTTTTCTCATCTTTGTAGG + Intergenic
974491145 4:62566689-62566711 TGAGCTTTTTTCATGTTTGTTGG + Intergenic
975476545 4:74830175-74830197 TGAGCTTTTTTCATGTTTGCTGG - Intergenic
976769907 4:88639960-88639982 TGAGCTTTTTTCATGTTTGTTGG - Intronic
977276884 4:94988834-94988856 GGGGCTTTTTTCATACTTTAGGG - Intronic
979293891 4:119008833-119008855 TGGCATCTTCTAATATTTGAAGG - Intronic
979980957 4:127254639-127254661 TGAGCTTTTTTCATGTTTGTTGG + Intergenic
980026387 4:127772622-127772644 TAGCCTTTTCTAATATTTCAAGG + Intronic
981738564 4:147978514-147978536 TGAGTTTTTCTCAGATCTGATGG + Intronic
981908578 4:149952462-149952484 AAGGATTTTCTCATATTTCAAGG + Intergenic
982509707 4:156266188-156266210 TGAGCTTTTTTCATGTTTGTTGG + Intergenic
982662527 4:158224169-158224191 TGAGCTTTTTTCATGTTTGTTGG + Intronic
982846642 4:160260866-160260888 TGAGCTTTTTTCATGTTTGTTGG + Intergenic
983244755 4:165275245-165275267 TGGACTCTTCTCATGTTTGTTGG + Intronic
983395260 4:167185962-167185984 TGGGCATATGTTATATTTGAGGG - Intronic
983717444 4:170801698-170801720 TTCCCTTTTTTCATATTTGAAGG - Intergenic
987740942 5:21907898-21907920 TGGGATGTTCTGATATTTGAGGG + Intronic
989420032 5:41226780-41226802 TGGGATTTCCTCATGTTTTAAGG + Intronic
990102999 5:52216198-52216220 TGAGCTTTTTTCATGTTTGTTGG + Intergenic
990665976 5:58072063-58072085 TGGCCTTTTATCTTTTTTGAGGG + Intergenic
991476888 5:67031268-67031290 TGGGCATTTCCCAGAGTTGATGG + Intronic
992188024 5:74262752-74262774 AGGGCTTTTCTAACCTTTGATGG - Intergenic
992743265 5:79795028-79795050 TGGGCTTTTTAAAGATTTGAGGG - Intronic
993753981 5:91704203-91704225 TGGGCCATTCTCTTATTTGATGG - Intergenic
994308118 5:98233010-98233032 TGGTCTTTTCTAAGATTTCAAGG - Intergenic
994358673 5:98825262-98825284 TTGGTTTTTCTCTTATTTTATGG - Intergenic
994735945 5:103556098-103556120 TGTGCTTTTCTTTTTTTTGAAGG - Exonic
994857300 5:105139851-105139873 TGGGCTTTTTTCTTAGCTGAAGG + Intergenic
994970618 5:106731664-106731686 TTGGCCTTTCTCATCTTTGTGGG - Intergenic
995694928 5:114867798-114867820 TGACTTTTTCTCATATTTGCGGG - Intergenic
996004274 5:118402420-118402442 TGAGCTTTTTTCATGTTTGTTGG + Intergenic
996032830 5:118725445-118725467 TTTGCTTTTCTAATATATGAAGG - Intergenic
996100214 5:119437608-119437630 TGAGCTTTCCACATATTTCAGGG + Intergenic
1001495560 5:172185840-172185862 AGGGCCTTGCCCATATTTGAGGG - Intronic
1002391745 5:178918937-178918959 GGGGCTTTACTCAGAATTGATGG - Intronic
1003943302 6:11049880-11049902 TGGGCATTTTTCATGTTTGGTGG + Intergenic
1005042809 6:21614731-21614753 TGGACATTTCACATTTTTGAAGG + Intergenic
1005123627 6:22420100-22420122 TGGGTTTATCTAGTATTTGAAGG - Intergenic
1005142196 6:22645837-22645859 TGTGATTTTCTCACATTTTAAGG + Intergenic
1005733502 6:28722058-28722080 TGTCCTTTTCTCATGTTTCATGG - Intergenic
1005782290 6:29204471-29204493 TGAGCTTTTTTCATGTTTGTTGG + Intergenic
1008844512 6:55946872-55946894 TGGACATTTCTGGTATTTGAAGG - Intergenic
1009504535 6:64459425-64459447 TGGGATATACTTATATTTGAAGG + Intronic
1009557207 6:65187254-65187276 TGGCTTTTTCTCTTGTTTGAAGG - Intronic
1010811937 6:80310858-80310880 TGCACTTTTTTCATGTTTGATGG + Intronic
1011062112 6:83282493-83282515 TGAGCTTTTTTCATGTTTGTTGG - Intronic
1011321418 6:86097740-86097762 TGGGCTTTTATCTTATTTTTTGG - Intergenic
1012490595 6:99779383-99779405 TGGTCCTTTCTCATCTTTGTGGG + Intergenic
1014092724 6:117422733-117422755 TGTGCTTTTATAATATTAGAGGG - Intronic
1014194426 6:118536671-118536693 TGGCCTTTTCTCTTATCTCATGG - Intronic
1014484249 6:121979680-121979702 TGAGCTTTTTTCATGTTTGTTGG + Intergenic
1015262090 6:131249814-131249836 TAGGCTGTTGACATATTTGATGG + Intronic
1015324423 6:131908338-131908360 TTGCTTTTCCTCATATTTGAGGG + Intergenic
1015639860 6:135319793-135319815 TGGGTTTATCTCATATTTTGAGG + Intronic
1016734297 6:147459801-147459823 CAGGGTTTTCTAATATTTGATGG + Intergenic
1017111353 6:150936085-150936107 TGGACTTTTTGAATATTTGAAGG + Intronic
1017271811 6:152515874-152515896 TTAGCTTTTCTCTTATTTGCAGG - Intronic
1017910395 6:158787444-158787466 TGAGATTTTCTAAGATTTGAAGG - Intronic
1019189241 6:170241108-170241130 TGGGTTTTTCTCACAATTAAAGG + Intergenic
1021642412 7:22752084-22752106 TGAGCTTTTTTCATGTTTGCTGG + Intergenic
1021693323 7:23251057-23251079 TTGGCTTTTGTCAGATGTGAAGG + Intronic
1021912147 7:25396948-25396970 TGGGCTTTTCTTATGATTCAAGG + Intergenic
1023395338 7:39746471-39746493 TGTGATTCTCTTATATTTGAGGG + Intergenic
1023857475 7:44193521-44193543 TGGGCTTTGCTCTGATTGGATGG + Intronic
1025089808 7:56052331-56052353 CGGGCTTTTCCCAGATTTTAGGG - Intronic
1027664665 7:81030429-81030451 TGTGCTTTTATCATTTTTGGTGG + Intergenic
1028165378 7:87532607-87532629 TGGGCTCTTCTCAGAACTGAGGG - Intronic
1028627819 7:92897403-92897425 TGGTCTTTTCACATATTTCTTGG + Intergenic
1028639960 7:93030571-93030593 TGGTTATTTCTCATATTTGTGGG - Intergenic
1029464250 7:100715463-100715485 TGGGCAGTGCTCATCTTTGACGG + Intergenic
1031506272 7:122587971-122587993 TGAGCTTTTCTCATGTTTGTTGG + Intronic
1031637050 7:124114262-124114284 TTGTCTTTTCTCATTTTTCATGG - Intergenic
1032455913 7:132073317-132073339 AGGGATTTTCTTGTATTTGAGGG + Intergenic
1032665940 7:134036395-134036417 TGGGGTTTCCTCATATTTGCTGG - Intronic
1032730328 7:134635631-134635653 TGGCCTTTTCTTATCTTTCATGG - Intergenic
1033576684 7:142691911-142691933 TTGGCTTTTCTTATCTGTGAAGG + Intergenic
1033693880 7:143766928-143766950 TGAGCTTTTCTCTTATCTCATGG - Intergenic
1033996308 7:147353901-147353923 TGAGCTTTTTTCATGTTTGTTGG + Intronic
1034313376 7:150109792-150109814 TGAGATTTTCTCTTATTTGCTGG - Intergenic
1034793485 7:153990872-153990894 TGAGATTTTCTCTTATTTGCTGG + Intronic
1034987791 7:155528017-155528039 TGGTGATTTCTAATATTTGAGGG - Intronic
1035194199 7:157201907-157201929 TGGGCTTATTTCATATTAGAAGG + Intronic
1037274631 8:17164857-17164879 TGGATTTTCATCATATTTGAAGG + Intronic
1037545589 8:19916968-19916990 TGGTCTTTTCACATATTTCTTGG + Intronic
1037638157 8:20719178-20719200 TGGGTTCTGCTCATATTTGTCGG - Intergenic
1038095313 8:24302698-24302720 TGAGCTTTTTTCATGTTTGTTGG + Intronic
1039245867 8:35607673-35607695 GGGGCTTTTTTCCTCTTTGATGG + Intronic
1039245872 8:35607710-35607732 AGGGCTTTTTTCCTCTTTGATGG + Intronic
1039774523 8:40722565-40722587 TGTGACTTTATCATATTTGATGG - Intronic
1040396281 8:47003572-47003594 TGGGCTTTGCCCATGTATGAGGG + Intergenic
1044127778 8:88479575-88479597 TGAGCTTTTTTCATATTTTTTGG - Intergenic
1044179687 8:89175330-89175352 TTCTCTTTTCTCATATTTCAGGG - Intergenic
1044706336 8:95012473-95012495 GGGGCATTTCTAATATTTGAAGG + Intronic
1048118909 8:131556432-131556454 AAGGCTTTTCACGTATTTGAAGG - Intergenic
1048877172 8:138845958-138845980 TGGCCTCTTCTCATATTTGAGGG + Intronic
1049988828 9:974387-974409 AATCCTTTTCTCATATTTGATGG - Intergenic
1050192795 9:3045932-3045954 AGGGCTTTTCACTTATTTGAGGG - Intergenic
1050782944 9:9361926-9361948 GGGGTTTTTCTCATATATGTTGG + Intronic
1051936173 9:22446041-22446063 TGGTCTTTTCTTATAATTAAAGG + Intergenic
1052951304 9:34214859-34214881 TGGGCATTTTTCATGTTTGTTGG - Intronic
1053048871 9:34941913-34941935 TGGGCATCTCTCATACTGGAAGG - Intergenic
1053087112 9:35234982-35235004 TGGTCTTTTCTCATCTTTCTTGG + Intronic
1054992449 9:71344973-71344995 TGAGCTTTTTTCATGTTTGTTGG - Intronic
1055082984 9:72285559-72285581 TTGTCTTTTCACATTTTTGATGG + Intergenic
1056622338 9:88224784-88224806 GAGGCTTGTCTCATAGTTGAAGG - Intergenic
1057926931 9:99160643-99160665 TATATTTTTCTCATATTTGATGG + Intergenic
1058184524 9:101839167-101839189 TGAGCTTTTTTCATGTTTGTTGG - Intergenic
1058346706 9:103972122-103972144 TGAGCTTTTTTCATGTTTGTTGG + Intergenic
1058802245 9:108555823-108555845 TGAGCCTTTCTCAGCTTTGATGG - Intergenic
1059361774 9:113748772-113748794 TGGGATTATCTGATTTTTGAAGG + Intergenic
1061565672 9:131438058-131438080 TGGTTTTCTCTCATATGTGAGGG + Intronic
1185844535 X:3425312-3425334 CTGGCTTTTCTCATCTCTGAGGG - Intergenic
1186506065 X:10093279-10093301 TGGGCTTTTCTCAAAGTTCTGGG - Intronic
1186648307 X:11531431-11531453 TGGGATTTTTTCATATTTCCAGG - Intronic
1186755862 X:12670969-12670991 TGAGCTTTTGTCATGTTTGTTGG - Intronic
1187646564 X:21354009-21354031 TGAGCTTTTTTCATGTTTGTTGG - Intergenic
1188738754 X:33750910-33750932 TGAGCTTTTTTCATGTTTGTTGG + Intergenic
1189455066 X:41179796-41179818 TTGGCTTTTCTCAGATTTAGTGG + Intronic
1189973950 X:46444290-46444312 TGGGCTTTTTCCACATCTGAAGG - Intergenic
1190651753 X:52574872-52574894 AGGGCTTGTCTCAGACTTGAAGG - Intergenic
1192421259 X:71033707-71033729 TGGGCTTTTTTTTTTTTTGATGG - Intergenic
1192723004 X:73720016-73720038 TGAGCTTTTTTCATGTTTGTTGG + Intergenic
1192921536 X:75712562-75712584 TGGTCTTTTCTCATTTGTGTAGG + Intergenic
1192957626 X:76090006-76090028 TGAGCTTTTTTCATTTTTGTTGG + Intergenic
1193270487 X:79524174-79524196 TGAGCTTTTCTCAATATTGAGGG - Intergenic
1193354352 X:80500453-80500475 TGGGCTTTTTTCATGTTTGTTGG - Intergenic
1193431204 X:81408125-81408147 TGGGAATTTCTCATTTTTAAAGG + Intergenic
1193434420 X:81454611-81454633 TGAGCTTTTTTCATATTTGTTGG - Intergenic
1193593673 X:83420149-83420171 TAGTTTTTTCTCATATTTGTGGG - Intergenic
1194033846 X:88846858-88846880 GGGGCTTTTCTGTTGTTTGATGG + Intergenic
1194344757 X:92750278-92750300 TGGGTCTTTCTCATCTTTGTGGG + Intergenic
1195126950 X:101817341-101817363 TGAGCTTTTTTCATGTTTGTTGG + Intergenic
1195149700 X:102053845-102053867 TTGTCTTTTCTGATATTTGTTGG - Intergenic
1195950233 X:110263449-110263471 TTTGGTATTCTCATATTTGAAGG - Intronic
1196193462 X:112817268-112817290 TGGGGTCTTCTCATTTTTGGCGG + Intronic
1196272924 X:113733758-113733780 TTGTCTTTTCTGATATTTGTTGG + Intergenic
1196293188 X:113967689-113967711 TGGTCTTTTCACATTTTTGATGG + Intergenic
1196531350 X:116790580-116790602 TGAGCTTTTTTCATGTTTGTTGG - Intergenic
1197029616 X:121797903-121797925 TGAGCTTTTTTCATGTTTGTTGG + Intergenic
1197490553 X:127111532-127111554 TGAGCTTTTTTCATGTTTGTTGG - Intergenic
1198627009 X:138587699-138587721 TGGACCTTTCTCATCTTTGTAGG + Intergenic
1199397374 X:147354983-147355005 TGAGCTTTTTTCATATTTGTTGG - Intergenic
1199706168 X:150427401-150427423 TTGGCTTTTCTTTTCTTTGAGGG + Intronic
1200653102 Y:5866918-5866940 TGGGTCTTTCTCATCTTTGTGGG + Intergenic
1200903963 Y:8462227-8462249 TGGACTTTTGTTATATTTCAGGG + Intergenic
1200907216 Y:8496158-8496180 TGGGATTTTGTCATATTGCAGGG + Intergenic