ID: 1157457993

View in Genome Browser
Species Human (GRCh38)
Location 18:47854809-47854831
Sequence AAATGGACCATTGTGGTTTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 240}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157457993 Original CRISPR AAATGGACCATTGTGGTTTG CGG (reversed) Intronic
903557402 1:24203624-24203646 AGGTGTGCCATTGTGGTTTGGGG - Intergenic
905854806 1:41302555-41302577 AAGTGGACCCTTGTGGTTGCAGG + Intergenic
906076027 1:43052714-43052736 GAGGGGACCATTATGGTTTGAGG + Intergenic
908400481 1:63768487-63768509 ACATGTGCCATGGTGGTTTGCGG + Intergenic
908610630 1:65856261-65856283 ACATGTGCCATGGTGGTTTGCGG + Intronic
908662613 1:66453228-66453250 AAATGGTCCTTAATGGTTTGTGG - Intergenic
908734793 1:67264883-67264905 AAATGGTCCATTTTTGTCTGGGG + Intergenic
909140874 1:71863528-71863550 ACATGTGCCATGGTGGTTTGGGG - Intronic
910294770 1:85633471-85633493 AAATTGACCAGTGTTGGTTGGGG - Intergenic
911098148 1:94072763-94072785 AAATAGATGATGGTGGTTTGGGG - Intronic
911572797 1:99538250-99538272 AAAAGGACAATTTTGGTGTGAGG + Intergenic
911694658 1:100876315-100876337 ACATGTACCATTGTGGTAGGAGG - Intronic
912993088 1:114508976-114508998 GAATGAAGCATTTTGGTTTGGGG - Intronic
913531215 1:119735590-119735612 AAACACACCTTTGTGGTTTGAGG + Intronic
915263035 1:154693132-154693154 AAATGAACCAATGTGGTTTGGGG - Intergenic
915351231 1:155227610-155227632 AAATGGACCAATGAGACTTGTGG - Intergenic
915658587 1:157382117-157382139 ACATGTGCCATGGTGGTTTGCGG + Intergenic
916441369 1:164828455-164828477 AAATGCAAGATTGTGTTTTGGGG + Intronic
917629385 1:176877843-176877865 AACTGGACCACTGTGTCTTGGGG - Intronic
917673651 1:177299218-177299240 AAATGGACCTTTATTGTTTGGGG + Intergenic
917826199 1:178823757-178823779 AGAAGGACCATTGTGGGCTGGGG + Intronic
919296540 1:195708992-195709014 AAATGGAGGATAGTGGTTTGGGG - Intergenic
919473502 1:198007951-198007973 AAAGATACCATTGTGGTTGGGGG + Intergenic
920732237 1:208497973-208497995 AAAGGGACCAGAGTGGTATGTGG + Intergenic
921239804 1:213167151-213167173 AAATGGACCTTGGTGATTAGAGG + Intronic
921395602 1:214665937-214665959 AAATGGACCTTTGTGTTATTGGG + Intergenic
923085505 1:230700516-230700538 AAATGGACCACTCTGGGTGGGGG + Intergenic
923820060 1:237428686-237428708 AAGTGTGCCATGGTGGTTTGCGG - Intronic
924782846 1:247168832-247168854 TAATGGACCTTGGTGATTTGGGG + Intronic
1063532800 10:6851831-6851853 AAATGAACCATATTGTTTTGGGG - Intergenic
1064304207 10:14150766-14150788 AAATGGAAATGTGTGGTTTGGGG - Intronic
1065113302 10:22460701-22460723 AGATATATCATTGTGGTTTGGGG - Intergenic
1065313772 10:24441906-24441928 AACTGGACAATTCTGCTTTGAGG + Intronic
1068164757 10:53314885-53314907 AAATGTACAATTGTGTTTTTTGG + Intergenic
1068412785 10:56678982-56679004 ACATGTGCCATGGTGGTTTGTGG - Intergenic
1070225979 10:74506250-74506272 GTAAGGACCATTGTGGTTGGGGG - Intronic
1070285675 10:75081871-75081893 AAAAAGAACATTCTGGTTTGTGG + Intergenic
1072901121 10:99407865-99407887 ACATGTGCCATGGTGGTTTGTGG + Intronic
1074436645 10:113440064-113440086 AAATGGATAAATGTGGCTTGGGG - Intergenic
1074724198 10:116290721-116290743 ACATGTGCCATGGTGGTTTGTGG + Intergenic
1074828392 10:117231162-117231184 TCTTGGACCTTTGTGGTTTGAGG - Intergenic
1074856736 10:117479485-117479507 AAATGCACCATTGCCTTTTGAGG - Intergenic
1078909642 11:15718918-15718940 AAAGGGAGCATTGTGGGGTGGGG - Intergenic
1078949881 11:16118235-16118257 TAATGGACAGTTGTGCTTTGGGG - Intronic
1080631648 11:34082603-34082625 AAATGTACCACTCTGGTTGGGGG - Intronic
1080677659 11:34442639-34442661 GAATGGCCCAAAGTGGTTTGAGG + Intronic
1081048886 11:38313142-38313164 GAGTAGAACATTGTGGTTTGGGG - Intergenic
1082130123 11:48478449-48478471 AAGTGTACCACTGTGGTGTGTGG - Intergenic
1082563648 11:54649358-54649380 AATTGTACCACTGTGGTGTGTGG - Intergenic
1086981951 11:93207748-93207770 AATTAGACCATTGTGATATGAGG - Intergenic
1090689941 11:129170268-129170290 ACATGTGCCATGGTGGTTTGTGG + Intronic
1092316066 12:7415498-7415520 ACATGTGCCATGGTGGTTTGGGG + Intronic
1092564609 12:9650870-9650892 AAATGGTGCAATGTGGTCTGTGG + Intergenic
1092985192 12:13838364-13838386 ATATGGACCTTTGTGTTTTCAGG - Intronic
1093057673 12:14570875-14570897 TAATGGACTTGTGTGGTTTGGGG + Intergenic
1093361494 12:18234916-18234938 ACATGTGCCATGGTGGTTTGCGG + Intronic
1093919832 12:24847317-24847339 AAATGTACCACTCTGGTGTGAGG - Intronic
1093964465 12:25310374-25310396 TAATGGACCAGTGTGATATGTGG - Intergenic
1094363350 12:29653465-29653487 AAATGGACAATTGGGCCTTGGGG + Intronic
1095069169 12:37818370-37818392 AAATGGATATTTGTGTTTTGAGG + Intergenic
1096655202 12:53085854-53085876 AAGTGTGCCATGGTGGTTTGCGG - Intergenic
1099146961 12:79058660-79058682 AAATTAACAATTGTGGTGTGGGG - Intronic
1104612032 12:130236706-130236728 AAATGGATCCTTGTCCTTTGGGG - Intergenic
1107815232 13:44238834-44238856 AACTGGTCCATGATGGTTTGGGG - Intergenic
1108552799 13:51563438-51563460 AAATGTACCACTGTGGTGGGGGG + Intergenic
1108950217 13:56083332-56083354 AGATGAACCATTGTGATTTGGGG + Intergenic
1109637414 13:65140753-65140775 ATAAGGACTATTTTGGTTTGCGG + Intergenic
1110885586 13:80630151-80630173 AAATGGAGCCTTCAGGTTTGTGG + Intergenic
1111730267 13:92066324-92066346 GAATGGACCATTGTGGCTGAAGG + Intronic
1113283575 13:108818896-108818918 GAATAGAGCATTGTGGTTTATGG - Intronic
1114589780 14:23851412-23851434 AAATATATTATTGTGGTTTGGGG - Intergenic
1114770327 14:25423649-25423671 ACATGTGCCATGGTGGTTTGTGG + Intergenic
1116352794 14:43886853-43886875 AAATTGACTATTGTGTTTTCTGG + Intergenic
1116990587 14:51271814-51271836 AAGAGGACCTTTGTGGTTTTGGG + Intergenic
1117478814 14:56122509-56122531 TAATGGCCCATGGTGGTTTTTGG + Intronic
1118172739 14:63404758-63404780 AAATGGACTTCTTTGGTTTGTGG - Intronic
1120180324 14:81336560-81336582 AAGTGGACCCTGCTGGTTTGTGG + Intronic
1124530998 15:30506430-30506452 AAATGTACCACTCTGGTGTGGGG + Intergenic
1124767657 15:32501265-32501287 AAATGTACCACTCTGGTGTGGGG - Intergenic
1127284794 15:57522983-57523005 AAATGGACCTTTGTTCTGTGGGG + Intronic
1128090025 15:64912913-64912935 CAATGGAGCATTGGGGTGTGTGG + Intronic
1129496226 15:75984231-75984253 GAATGTACCATTCTGGTTGGTGG + Intronic
1132017205 15:98328675-98328697 AAATGGGCACTTGTGGCTTGGGG - Intergenic
1134221327 16:12356681-12356703 TAATTGAATATTGTGGTTTGAGG + Intronic
1134824761 16:17275624-17275646 AAATAGAATATTGTGGTTTGTGG - Intronic
1137409861 16:48219147-48219169 AAATGGACTGTTTTGGTTTTGGG + Intronic
1137492003 16:48940846-48940868 AGATGGAAAATTGTGGTTTGTGG - Intergenic
1140182164 16:72730736-72730758 ATATGTGCCATGGTGGTTTGCGG + Intergenic
1140276810 16:73516639-73516661 AAAGGGATGATTTTGGTTTGGGG - Intergenic
1141300178 16:82807749-82807771 AAATGCTCCATTGTGGTGTTTGG - Intronic
1142000432 16:87661220-87661242 ACAAGGACCCTTGTGGTTCGGGG + Intronic
1144136830 17:12303031-12303053 AGAAGGACCAGTGTGGATTGAGG - Intergenic
1145744331 17:27302936-27302958 AAACTGATCATTATGGTTTGAGG + Intronic
1148879698 17:50716414-50716436 ACATGCACCATTATAGTTTGTGG + Intergenic
1154960149 18:21300200-21300222 AAATGGATCATTGCAGTTTATGG + Intronic
1155421939 18:25665499-25665521 GTTTGGACCATTGTGTTTTGGGG - Intergenic
1155702264 18:28761565-28761587 AAAGGGATCAGGGTGGTTTGTGG - Intergenic
1155808444 18:30202042-30202064 AAATGAACCATTGTGGATGTTGG + Intergenic
1157457993 18:47854809-47854831 AAATGGACCATTGTGGTTTGCGG - Intronic
1157944225 18:51960480-51960502 TATTGGAGCATTGTGGTGTGAGG - Intergenic
1157988486 18:52467118-52467140 ACATGTGCCATGGTGGTTTGTGG + Intronic
1158048399 18:53185428-53185450 AAATAGACCAATGTGGCTTGTGG - Intronic
1158280345 18:55818588-55818610 AAAAGGACCAATGTGGATTAAGG + Intergenic
1158926554 18:62269967-62269989 TAATAGACCATTATGTTTTGGGG - Intronic
1159690361 18:71479477-71479499 AAGTGTGCCATGGTGGTTTGCGG - Intergenic
1163597792 19:18230560-18230582 AAATGGATCAGTGTGGCTTGAGG - Intronic
1166012697 19:39954924-39954946 AAATGGATGATTGTGGTTCTGGG - Intergenic
1167160099 19:47761782-47761804 AAATGGCACATTGGGGTTTCGGG + Intergenic
1167501054 19:49848418-49848440 AAATGACTCATTGTGGTTTGTGG - Intergenic
925420847 2:3710262-3710284 ACATGTGCCATGGTGGTTTGTGG + Intronic
925441211 2:3887370-3887392 ACATGTGCCATGGTGGTTTGTGG + Intergenic
925555522 2:5127179-5127201 AAGGGGACAATTGTGGTTTTTGG - Intergenic
925613268 2:5721276-5721298 AAATCCACCTTTGTGGTTTTCGG - Intergenic
928496159 2:31834452-31834474 ACATGTGCCATGGTGGTTTGTGG + Intergenic
928531034 2:32191182-32191204 AAATGCACCAATGTTATTTGTGG - Intronic
928596573 2:32864577-32864599 AAATGGAACCTTCTGGTTGGAGG - Intergenic
930804410 2:55475896-55475918 AATTGTACCATTTTGTTTTGAGG - Intergenic
931535527 2:63271575-63271597 ACATGCACCATTGTGGTGCGGGG + Intronic
935567398 2:104623833-104623855 ACATGTGCCATGGTGGTTTGTGG + Intergenic
936834437 2:116690374-116690396 AAATGGATCATTGTCTTGTGTGG - Intergenic
937760185 2:125591267-125591289 ACATGTGCCATGGTGGTTTGGGG - Intergenic
938550085 2:132372115-132372137 ATGTGGACCATTGTAATTTGGGG + Intergenic
938613170 2:132970096-132970118 AAATGGACTATGGTGATCTGTGG - Intronic
938846558 2:135215809-135215831 AAATGGATAATTCTGTTTTGGGG + Intronic
940805355 2:158180936-158180958 AAAGGGAGCATTCTGGTTTGTGG - Intronic
941270742 2:163424669-163424691 GAATGGACCTTTGAGTTTTGGGG - Intergenic
942795759 2:179816864-179816886 CAACGGACCAGTGTGGTTTATGG + Intronic
943296633 2:186148349-186148371 ATATGTACCACGGTGGTTTGCGG - Intergenic
944138571 2:196429327-196429349 AAATGGACCCTTGTGGGGTCTGG + Intronic
945182043 2:207101863-207101885 AAAGGGACCATTTGGTTTTGTGG - Intronic
945965818 2:216185316-216185338 AAATTGGCCATTGTGGGTAGAGG - Intronic
946806298 2:223474268-223474290 AAGTTGACCATAGGGGTTTGAGG + Intergenic
947944435 2:234089511-234089533 AAATGCACCACTGTGGTGTGTGG + Intergenic
948855291 2:240727476-240727498 AGATGGACCATGGAGGTTTTTGG - Intronic
1170866629 20:20163675-20163697 ACATGTGCCATGGTGGTTTGCGG + Intronic
1173720196 20:45251621-45251643 GAATGGTCCAGTGAGGTTTGGGG + Intergenic
1174257823 20:49271448-49271470 CATTGGACCATGGTGGTCTGCGG + Exonic
1174982586 20:55413210-55413232 AAATGCATCACTGTGGTTTTTGG - Intergenic
1175066954 20:56297163-56297185 AAAGGGACCGTAGTGGATTGGGG - Intergenic
1177114906 21:17073493-17073515 AAATGGATATTTCTGGTTTGGGG + Intergenic
1177712149 21:24791324-24791346 AAATGGACAATACTGGTTTATGG - Intergenic
1177719990 21:24893419-24893441 ACATGTGCCATGGTGGTTTGCGG + Intergenic
1182641224 22:31769308-31769330 AAATGCACTATAGTAGTTTGAGG + Intronic
1183621446 22:38975241-38975263 AAATGGACTATTGCAGTTAGAGG + Intronic
1184181073 22:42826691-42826713 AAATGCAGCATTGTGGCTGGGGG - Intronic
1184719706 22:46303993-46304015 AAATATACCTTTGTGGTTTTTGG + Intronic
949247109 3:1938136-1938158 ACATGTGCCATGGTGGTTTGCGG - Intergenic
952156207 3:30646372-30646394 AGAGGGACCAGTGTGGTTAGAGG + Intronic
953822028 3:46215049-46215071 CAGTGGCTCATTGTGGTTTGAGG + Intronic
956725381 3:72152561-72152583 AGATGGAGCATTGTCCTTTGCGG - Intergenic
959001046 3:100964641-100964663 AAATGGACAATTGTGCCTTCAGG - Intronic
959665883 3:108920890-108920912 AAATGTACCATTCTGGTGGGAGG - Intronic
959702511 3:109311293-109311315 ATGTGGACCATTGTTGATTGGGG - Intronic
960009854 3:112821876-112821898 AAATGGACCTTGCTGGTCTGCGG + Intronic
961480849 3:127179297-127179319 AAATGGGACATTGAGGTTTCAGG + Intergenic
961993569 3:131217573-131217595 AAATGTACCATCTAGGTTTGTGG - Intronic
963362042 3:144286900-144286922 ATAAGGACCATTGAGGGTTGAGG + Intergenic
964942599 3:162177584-162177606 AAATGGACCCTTATGTTTTCTGG + Intergenic
965208018 3:165747013-165747035 AAATCCACAATTGTTGTTTGAGG + Intergenic
965638932 3:170812781-170812803 AAATGGACCTCTGTGGTAAGTGG - Intronic
965823552 3:172708766-172708788 CAAGGGTCCATTGTGGATTGTGG - Intronic
966219475 3:177536096-177536118 AAAGGGATCATTATTGTTTGGGG + Intergenic
968321451 3:197772455-197772477 ACATGTGCCATGGTGGTTTGCGG - Intronic
971415997 4:26430475-26430497 AAATTTACGAGTGTGGTTTGGGG + Exonic
975511546 4:75199051-75199073 ACATGTGCCATGGTGGTTTGCGG + Intergenic
975740472 4:77424757-77424779 AGATGGACCACTGTGGTGGGGGG + Intronic
976670084 4:87642330-87642352 ACATGTGCCATGGTGGTTTGTGG - Intergenic
977111700 4:92964469-92964491 ACATGTGCCATGGTGGTTTGTGG - Intronic
977137013 4:93317603-93317625 AAATGCAGCATTGCAGTTTGGGG - Intronic
977258356 4:94765690-94765712 AAATGAAAAATTGGGGTTTGAGG + Intronic
977828296 4:101559270-101559292 ACATGTGCCATTGTGGTTTGCGG - Intronic
978877536 4:113659836-113659858 AAAAGGAACCTTCTGGTTTGAGG - Intronic
979902142 4:126235316-126235338 AAATGTACCATTGTGGTGAGAGG - Intergenic
980732642 4:136842861-136842883 ACATGTGCCATGGTGGTTTGTGG + Intergenic
982047940 4:151467916-151467938 ACATGTGCCATGGTGGTTTGCGG - Intronic
982189268 4:152836943-152836965 CAATGGACTTTAGTGGTTTGGGG - Intronic
982527900 4:156502822-156502844 GAATGGACCATTTTGGTAGGTGG - Intergenic
982609827 4:157559159-157559181 GAATGCATCAATGTGGTTTGTGG - Intergenic
984333803 4:178361281-178361303 AAATGTACCATAGAGGTTTGAGG - Intergenic
984831112 4:183974734-183974756 AAATGGACAATTATAGTTAGGGG + Intronic
987529120 5:19094328-19094350 ACATGTGCCATGGTGGTTTGTGG + Intergenic
987840632 5:23218900-23218922 AAAAGGATCATGGTGGTTGGAGG - Intergenic
989059937 5:37400617-37400639 ATATGGACAAATGTGGTTTCTGG - Intronic
989246342 5:39259074-39259096 GAATGGCCCATGGTGGTGTGAGG - Intronic
989623849 5:43410823-43410845 AAATTCACCATTGAGATTTGGGG - Intronic
989737976 5:44731502-44731524 ACATGTGCCATGGTGGTTTGAGG + Intergenic
990888721 5:60624793-60624815 ACATGTGCCATGGTGGTTTGTGG + Intronic
994802048 5:104390971-104390993 AAATGGTTCATTGAGGTTGGAGG + Intergenic
996060180 5:119024379-119024401 ACATGTGCCATGGTGGTTTGCGG + Intergenic
996913644 5:128684457-128684479 AAAAGAACCATTGTGGAATGGGG - Intronic
997430675 5:133838408-133838430 AACTGGACAATTTTGGCTTGGGG + Intergenic
997430685 5:133838463-133838485 AGCTGGACGATTCTGGTTTGGGG + Intergenic
998503202 5:142651442-142651464 AAATGGACCAGTGTGGTTGGTGG - Intronic
999488111 5:152020747-152020769 ACATGTGCCATGGTGGTTTGCGG + Intergenic
1001411736 5:171517153-171517175 AAATGGAACATGGTGGCTGGGGG - Intergenic
1005392098 6:25344226-25344248 CAATGGACTATTGAGGTTGGAGG - Intronic
1005686211 6:28255278-28255300 AAATGGCTCATAGGGGTTTGAGG + Intergenic
1008169039 6:48179745-48179767 AAATGGACCAGTCTGGTGGGGGG + Intergenic
1008217830 6:48816840-48816862 AAATGCACAATTGTGGGTTCAGG + Intergenic
1009570818 6:65381554-65381576 ACATGTACTATGGTGGTTTGCGG - Intronic
1011571354 6:88740054-88740076 AAAAGGAACATTGTGATTTTAGG - Intronic
1011988693 6:93483919-93483941 ACATGCGCCATGGTGGTTTGTGG - Intergenic
1012449441 6:99339313-99339335 AAAAGGACCAGAGTAGTTTGGGG + Intronic
1012812139 6:103972500-103972522 ATATGGCCCATTGTGTCTTGTGG - Intergenic
1014097043 6:117471926-117471948 AAATACACCAAGGTGGTTTGGGG + Intronic
1014268775 6:119312764-119312786 AAATGCACCACTGTGGGTTGAGG + Intronic
1014406029 6:121052304-121052326 CAATGAACCATTGTGGGTTTGGG + Intergenic
1015257007 6:131189279-131189301 AATTGAACCTTTGTAGTTTGAGG + Intronic
1015796628 6:137018990-137019012 AAATTGAACATTTTGGTTTGTGG + Intronic
1016626517 6:146175911-146175933 TAATAGGCCATTGTGGTTTTGGG + Intronic
1020221155 7:6238733-6238755 AAATGGACCACTGTGGTGAAGGG + Intronic
1020810548 7:12845621-12845643 ACATGTGCCATGGTGGTTTGTGG - Intergenic
1021162751 7:17297357-17297379 AAAAGAACAATTGTGTTTTGTGG - Intergenic
1021704663 7:23354871-23354893 GGATGGAGCACTGTGGTTTGAGG - Intronic
1021807852 7:24374742-24374764 AATTGGCCCATTTTGGTTTGGGG - Intergenic
1025923181 7:65934006-65934028 AAATGTAACATTGTGGAGTGGGG - Intronic
1026680871 7:72465700-72465722 ACATGGATCATTGAGGTCTGCGG + Intergenic
1028614793 7:92754358-92754380 AAAGAGACCATTTTGCTTTGGGG - Intronic
1028776767 7:94685898-94685920 ATATGTGCCATGGTGGTTTGTGG - Intergenic
1028940527 7:96517265-96517287 AAATGTACCATTCTGGTGGGAGG + Intronic
1030503193 7:110385784-110385806 AAATGGACAAAAGTGTTTTGAGG + Intergenic
1030824328 7:114136570-114136592 AAATGGACTATGGTCTTTTGAGG + Intronic
1033773011 7:144574698-144574720 ACATGTGCCATGGTGGTTTGGGG + Intronic
1033823885 7:145165809-145165831 ACATGTGCCATGGTGGTTTGTGG + Intergenic
1035689485 8:1550409-1550431 AAATGGCCCACTGTGTTTAGAGG - Intronic
1036652783 8:10655663-10655685 AAATGGATCATTTTGGTTTTAGG + Intronic
1037363158 8:18095116-18095138 ACATGTGCCATAGTGGTTTGCGG - Intergenic
1037712064 8:21362625-21362647 AAATGGACCAGTGAGGTCTTGGG - Intergenic
1038268332 8:26053313-26053335 AAATGAACCAGGGTTGTTTGTGG - Intergenic
1039095790 8:33883551-33883573 AAATGTACCACTCTGGTGTGGGG + Intergenic
1039331252 8:36539476-36539498 AAAAGGACCATTGTAAATTGGGG - Intergenic
1040658095 8:49535677-49535699 AAAAGGACCCCTGGGGTTTGTGG - Intergenic
1044136618 8:88593729-88593751 AAATGCAGCATTGTCGTTTGGGG + Intergenic
1046665174 8:116994185-116994207 AACTGGACCTCTGTGATTTGTGG + Intronic
1046915825 8:119677204-119677226 ACATGTGCCATGGTGGTTTGCGG - Intergenic
1050095126 9:2056928-2056950 AAATGGACCCTTGTGGGTGGTGG + Intronic
1053613498 9:39740087-39740109 AAATTTACAAGTGTGGTTTGGGG - Intergenic
1053871539 9:42498044-42498066 AAATTTACAAGTGTGGTTTGGGG - Intergenic
1054240016 9:62602310-62602332 AAATTTACAAGTGTGGTTTGGGG + Intergenic
1054554149 9:66636836-66636858 AAATTTACAAGTGTGGTTTGGGG + Intergenic
1061581809 9:131542179-131542201 AAATGTACCACTCTGGTGTGGGG - Intergenic
1203397716 Un_KI270519v1:42630-42652 AAGTGGACACTTGTGCTTTGAGG - Intergenic
1186124587 X:6399322-6399344 ACATGTGCCATGGTGGTTTGCGG - Intergenic
1189425094 X:40892626-40892648 ACATGTGCCATGGTGGTTTGCGG - Intergenic
1189538020 X:41956482-41956504 AATTGGCCCATGGTGGATTGGGG + Intergenic
1190285874 X:48961192-48961214 AAATGAAAGAGTGTGGTTTGAGG - Intergenic
1192716975 X:73653271-73653293 ACGTGTACCATGGTGGTTTGCGG - Intronic
1196313704 X:114197989-114198011 AAATGTACCACTCTGGTTGGGGG + Intergenic
1196456544 X:115895349-115895371 AAGTGGACCAATGTGTTTTGTGG - Intergenic
1198957325 X:142147203-142147225 AAATGCACCATTGACGTTTAGGG + Intergenic
1199238106 X:145513491-145513513 AAATCTGCCATTATGGTTTGGGG - Intergenic
1200684804 Y:6248513-6248535 AAACAGTCCTTTGTGGTTTGGGG - Intronic
1200990334 Y:9339778-9339800 AAACAGTCCTTTGTGGTTTGGGG - Intronic
1200992995 Y:9360093-9360115 AAACAGTCCTTTGTGGTTTGGGG - Intronic
1200995649 Y:9380371-9380393 AAACAGTCCTTTGTGGTTTGGGG - Intronic
1200998314 Y:9400717-9400739 AAACAGTCCTTTGTGGTTTGGGG - Intronic
1201000822 Y:9469249-9469271 AAACAGTCCTTTGTGGTTTGGGG - Intronic
1201003490 Y:9489581-9489603 AAACAGTCCTTTGTGGTTTGGGG - Intronic
1201006146 Y:9509863-9509885 AAACAGTCCTTTGTGGTTTGGGG - Intergenic
1201008804 Y:9530176-9530198 AAACAGTCCTTTGTGGTTTGGGG - Intronic
1201011378 Y:9550346-9550368 AAACAGTCCTTTGTGGTTTGGGG - Intergenic
1201609204 Y:15822242-15822264 ACATGTACCTTGGTGGTTTGCGG - Intergenic
1202147834 Y:21819015-21819037 CAATGGCCCAATGTGGTTTAAGG - Intergenic