ID: 1157464245

View in Genome Browser
Species Human (GRCh38)
Location 18:47930623-47930645
Sequence CGCCGCCCGCGGGGAAGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 5, 3: 16, 4: 238}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157464245 Original CRISPR CGCCGCCCGCGGGGAAGGAG GGG Intronic