ID: 1157464293

View in Genome Browser
Species Human (GRCh38)
Location 18:47930773-47930795
Sequence GTGCGTGGCGCCGCGGCGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 206}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157464293_1157464299 -5 Left 1157464293 18:47930773-47930795 CCGGCCGCCGCGGCGCCACGCAC 0: 1
1: 0
2: 3
3: 15
4: 206
Right 1157464299 18:47930791-47930813 CGCACCCACCTCCCGGCGGCTGG 0: 1
1: 0
2: 2
3: 12
4: 146
1157464293_1157464297 -9 Left 1157464293 18:47930773-47930795 CCGGCCGCCGCGGCGCCACGCAC 0: 1
1: 0
2: 3
3: 15
4: 206
Right 1157464297 18:47930787-47930809 GCCACGCACCCACCTCCCGGCGG 0: 1
1: 0
2: 1
3: 18
4: 165
1157464293_1157464302 -1 Left 1157464293 18:47930773-47930795 CCGGCCGCCGCGGCGCCACGCAC 0: 1
1: 0
2: 3
3: 15
4: 206
Right 1157464302 18:47930795-47930817 CCCACCTCCCGGCGGCTGGCGGG 0: 1
1: 0
2: 4
3: 21
4: 251
1157464293_1157464300 -2 Left 1157464293 18:47930773-47930795 CCGGCCGCCGCGGCGCCACGCAC 0: 1
1: 0
2: 3
3: 15
4: 206
Right 1157464300 18:47930794-47930816 ACCCACCTCCCGGCGGCTGGCGG 0: 1
1: 0
2: 1
3: 11
4: 155
1157464293_1157464306 6 Left 1157464293 18:47930773-47930795 CCGGCCGCCGCGGCGCCACGCAC 0: 1
1: 0
2: 3
3: 15
4: 206
Right 1157464306 18:47930802-47930824 CCCGGCGGCTGGCGGGCTGCTGG 0: 1
1: 0
2: 1
3: 37
4: 373
1157464293_1157464308 10 Left 1157464293 18:47930773-47930795 CCGGCCGCCGCGGCGCCACGCAC 0: 1
1: 0
2: 3
3: 15
4: 206
Right 1157464308 18:47930806-47930828 GCGGCTGGCGGGCTGCTGGCTGG 0: 1
1: 0
2: 3
3: 75
4: 395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157464293 Original CRISPR GTGCGTGGCGCCGCGGCGGC CGG (reversed) Intronic
900158883 1:1214103-1214125 GTGCGTGGGGGCTCGGCGGCTGG - Exonic
900237449 1:1599525-1599547 GTCTCTGGCGCGGCGGCGGCGGG + Exonic
900344597 1:2204959-2204981 GCGCGTGGCGCCCGGGGGGCGGG - Intronic
900364803 1:2306774-2306796 GTCGGCGGCGCTGCGGCGGCAGG - Exonic
902916701 1:19644143-19644165 GGAGGGGGCGCCGCGGCGGCAGG - Intronic
903413960 1:23168737-23168759 GTCCGTGAGGCGGCGGCGGCGGG - Intronic
903462697 1:23530612-23530634 GTGCCTGGCGCCGCTGCGGGAGG + Exonic
904160407 1:28518553-28518575 GTGAGAGGCGCGGCGGCGGAGGG - Intronic
904181396 1:28668986-28669008 GTGCGTGCCGCCGCCGCCGCCGG + Intronic
905167017 1:36088761-36088783 GTGCGCGGCGCCGCGACTCCGGG + Intergenic
908544129 1:65147913-65147935 GTGCGTGGGGCGGCGGGGGCTGG + Exonic
913205527 1:116534642-116534664 GTGGGCAGCGCCGCCGCGGCGGG - Intronic
914758377 1:150579441-150579463 GCGGGTGGCGCCGCCGCTGCCGG + Exonic
916233350 1:162561663-162561685 ATCCGGGGGGCCGCGGCGGCGGG - Exonic
919878725 1:201888814-201888836 CTGCGCGGAGCCGCGCCGGCTGG + Exonic
920394168 1:205631818-205631840 GCGCCAGGAGCCGCGGCGGCGGG - Exonic
922287593 1:224183449-224183471 GTGCGTGGCCTCCCGGCGCCGGG + Intronic
922586410 1:226737555-226737577 GCGCGCGGAGCCGCGGCTGCCGG - Exonic
924729288 1:246697139-246697161 GAGCGTGGCCCAGCGGCCGCAGG + Intergenic
1063298055 10:4826286-4826308 GTGCGGGGCGGCGGGGCGGCGGG + Exonic
1063429697 10:5977699-5977721 CTGTGCGGTGCCGCGGCGGCCGG - Intronic
1064354285 10:14603991-14604013 GCGGGGGGCGCCGCGGAGGCGGG - Intronic
1065100380 10:22325599-22325621 GGGCGGCGCGCCGCGGGGGCGGG - Intronic
1076853299 10:133103481-133103503 GTGCAGGCCGCCGGGGCGGCGGG - Intronic
1076916346 10:133424574-133424596 GAGCGCGGAGCCGCGGCGCCTGG + Intergenic
1076936453 10:133569369-133569391 GAGCGCGGAGCCGCGGCGCCTGG + Intronic
1077028033 11:450408-450430 GTGCGTGGGGTCGAGGCGCCGGG + Exonic
1077051374 11:568446-568468 GGGCGTGGAGCCGCGGGGCCCGG - Intergenic
1077051523 11:568897-568919 GTGCGGGGCACGGAGGCGGCCGG - Intergenic
1079223847 11:18588487-18588509 GGGCTTGGAGCCGGGGCGGCTGG - Intronic
1082174946 11:49048758-49048780 GTGCGTGGGGAAGAGGCGGCTGG - Intergenic
1082657765 11:55873179-55873201 GTGCGTGGGGAAGAGGCGGCTGG - Intergenic
1083571563 11:63764383-63764405 GGGCGCGGCCCCGCGGCGACCGG + Exonic
1083572656 11:63768636-63768658 GAGCGGGGCCCCGGGGCGGCGGG + Exonic
1084086270 11:66856779-66856801 GAGGTTCGCGCCGCGGCGGCGGG + Intronic
1084263241 11:67991886-67991908 GTGCGGGGCGAGGCGGCCGCGGG - Intronic
1085643327 11:78207145-78207167 GTGCGAGGGGCTGCTGCGGCTGG + Intronic
1086690828 11:89787328-89787350 GTGCGTGGGGAAGAGGCGGCTGG + Intergenic
1086697693 11:89864177-89864199 GTGCGTGGGGAAGAGGCGGCTGG - Intergenic
1086708468 11:89980311-89980333 GTGCGTGGGGAAGAGGCGGCTGG + Intergenic
1086714972 11:90052327-90052349 GTGCGTGGGGAAGAGGCGGCTGG - Intergenic
1090029462 11:123194978-123195000 CTGCTTGGCTCCGGGGCGGCCGG + Exonic
1091178100 11:133579657-133579679 GTGCGTGGAGCCGGGGAAGCTGG - Intergenic
1095097653 12:38156873-38156895 GTGCGTGTCGCCCCCACGGCGGG + Intergenic
1095687359 12:45050971-45050993 GTGCGGGGCGCCCGGGCGACAGG - Exonic
1096284145 12:50283548-50283570 GTGCGCGCCCCCGCGGCGGTGGG - Intergenic
1096647594 12:53047191-53047213 GCGCGGGGCGCGGCGGGGGCGGG + Intronic
1096792755 12:54055089-54055111 GTGCTGGGCGCAGCGCCGGCCGG - Exonic
1097850287 12:64404577-64404599 TTGCGTGGCGCCGGGCAGGCAGG - Exonic
1097981750 12:65742553-65742575 GCGCGTGGCCCGGCCGCGGCGGG - Intergenic
1101253862 12:102958593-102958615 TTGCGGCGCGCCACGGCGGCCGG - Exonic
1101371714 12:104137574-104137596 GGGCGCGGGGCCGGGGCGGCCGG - Intronic
1104692812 12:130839273-130839295 GTGCGGGGCGCGGCGCGGGCCGG - Intergenic
1104989595 12:132618428-132618450 GTGGGGGGCGCCGCGGAGGCCGG + Intergenic
1110573065 13:77026937-77026959 GCGCGGGGGGCCGCGGCTGCGGG - Exonic
1118030463 14:61813019-61813041 GCGCCTGGCGCCGAGGCGGAGGG + Intergenic
1118619322 14:67600288-67600310 GGGCGTGGTGACGCGGCTGCCGG - Intergenic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1122768183 14:104085580-104085602 GTGGGAGGCCCCGCGGAGGCGGG - Intergenic
1122779156 14:104136365-104136387 GTGCGGGGCGCGGCGGCGGCGGG + Intergenic
1122900580 14:104780716-104780738 GTGGGTGGCGGCGGGGCGGGGGG - Intronic
1125606316 15:40941770-40941792 CTGCGGGGCACGGCGGCGGCAGG - Intergenic
1130115416 15:81001375-81001397 GGGCGTGCCGCCGCGGCGCCGGG + Exonic
1131200041 15:90388401-90388423 GTGCGGGGCTCCGCGGCGCGGGG + Intronic
1132519716 16:381651-381673 GGGCGTGGGGCCGGGGCTGCGGG - Intronic
1132589730 16:721415-721437 GCGCGTGCCGCTGCGGCTGCAGG + Exonic
1132882144 16:2167206-2167228 ATGCCTGGCCCCTCGGCGGCAGG + Intronic
1133156670 16:3880796-3880818 GTGCGTGGTGACGCCGCGGGGGG - Intergenic
1137655129 16:50153137-50153159 CTGCGCGGCGCAGCGGGGGCGGG + Intronic
1142271789 16:89093786-89093808 CGGCGCGGCGCCGTGGCGGCGGG - Intronic
1142586873 17:979479-979501 CTGCGGGGGGACGCGGCGGCCGG - Exonic
1142848136 17:2691942-2691964 GGGCGTGGCGGGGCGGGGGCGGG - Intronic
1143202607 17:5122839-5122861 GTCTGTGGCCCCGCGGCGGGGGG + Intronic
1144656885 17:17042597-17042619 GTCCATGGGCCCGCGGCGGCCGG + Intronic
1144840637 17:18183785-18183807 GCGCGCGGAGCCGCGGTGGCCGG + Intronic
1145265173 17:21376546-21376568 GTGCGGGGCGCCGGGGCGTAGGG + Exonic
1146126538 17:30235827-30235849 GAGCGCGGAGCCGCGGCCGCGGG - Exonic
1146654400 17:34626666-34626688 GTGGGTGGCGCAGCGGGGGCTGG - Intronic
1146914824 17:36671886-36671908 GTGCAGGGCGCCGTGGAGGCAGG + Intergenic
1147158613 17:38558315-38558337 GTCGGAGGCGGCGCGGCGGCAGG - Exonic
1147429616 17:40363380-40363402 GAGCGTGGCGCTGCGCCTGCTGG - Exonic
1147907595 17:43833049-43833071 GAGCTGGGCGCCGCGGCGGGAGG - Intronic
1148367080 17:47063630-47063652 GTGGGTGGCGCTGAGGCGGGAGG - Intergenic
1151611936 17:75182332-75182354 CTGCCTGGGGCCGCGGCGGCGGG - Intergenic
1152262031 17:79272525-79272547 CTGCGTGGCCCCGCGTGGGCAGG - Intronic
1152433026 17:80260282-80260304 GTGCTGGGCGCCGGGGCGGGGGG + Intergenic
1152721898 17:81927505-81927527 GTGAGTGCGGCTGCGGCGGCGGG - Intronic
1153935057 18:9914027-9914049 GTGCGCGTGGCCGTGGCGGCTGG + Intronic
1155218271 18:23662432-23662454 GTGCCCGGCGACGGGGCGGCGGG - Intronic
1157464293 18:47930773-47930795 GTGCGTGGCGCCGCGGCGGCCGG - Intronic
1158458848 18:57630348-57630370 GTTCGTGGCGCCGCGCCTCCGGG + Intergenic
1160025083 18:75209707-75209729 GCGCGTGCGGCAGCGGCGGCAGG - Intergenic
1160853549 19:1206054-1206076 CCGCGGGGCGGCGCGGCGGCGGG - Intronic
1160871700 19:1280755-1280777 GAGCGGGGGGCGGCGGCGGCTGG - Intergenic
1162054829 19:8056270-8056292 GTGAGTGGGGCCGTGGGGGCTGG + Intronic
1164693520 19:30227446-30227468 GTGCGGGTGGCAGCGGCGGCCGG + Intergenic
1165571201 19:36776105-36776127 GAGCCAGGCGGCGCGGCGGCGGG + Exonic
1165721491 19:38082425-38082447 CTGCGCGGGGCCTCGGCGGCGGG + Exonic
1166094536 19:40530693-40530715 GGGCGGGGCGGCGCGGGGGCGGG + Intronic
925069063 2:951523-951545 GTGCATGGCGCGGCCTCGGCAGG + Intronic
925609927 2:5693862-5693884 CTGGGGGGCGGCGCGGCGGCCGG + Exonic
926027224 2:9555819-9555841 GTGCGGGGGACAGCGGCGGCCGG - Intergenic
927713876 2:25341060-25341082 GTGCGGGGCGCCGGCGGGGCCGG - Intronic
930089538 2:47521600-47521622 GAGCGCGGAGCCGCGGCGGAAGG + Exonic
930383713 2:50664433-50664455 GTGTGTGGCGTGGCGGGGGCGGG + Intronic
934467190 2:94273389-94273411 GGGCGGGGAACCGCGGCGGCAGG + Intergenic
935046839 2:99490158-99490180 GGGCGTAGCACCGCGGCGCCCGG + Intergenic
936396959 2:112138541-112138563 GTGCGGGGCGCCGCGCGGCCGGG - Exonic
937917651 2:127106803-127106825 GGCCGGGGCTCCGCGGCGGCTGG + Intronic
942045436 2:172096915-172096937 GAGCGTGTCTGCGCGGCGGCGGG + Intergenic
945102503 2:206274947-206274969 GTGAGTGCCGCGGCGGGGGCGGG + Intronic
948116035 2:235494632-235494654 GGGCGCGGGGCGGCGGCGGCGGG + Exonic
948216713 2:236237814-236237836 GTGCAGGGCGCCGCGGCCGCCGG + Exonic
948479105 2:238239464-238239486 GTGAGTGGCGGCGGGGCGGGCGG - Intronic
1170150304 20:13221083-13221105 GTGCGGGGCGGCGCGGCAGGCGG + Intergenic
1171034738 20:21705954-21705976 CTGCCTGGCGCCGGGGTGGCCGG - Exonic
1171123708 20:22584899-22584921 GTGCGGGGCGCCGCGGCGGTGGG - Intronic
1172252487 20:33489868-33489890 GCGCGTGACGCCGAGGGGGCAGG + Intergenic
1173820158 20:46014275-46014297 GTGAGCGCCGCCGCGGCCGCCGG + Intronic
1174045442 20:47729665-47729687 GTGAGAGGCGCCGGGGAGGCGGG + Intronic
1174204248 20:48827766-48827788 GAGCTGGGCGCCGCGGCGCCAGG + Exonic
1176013160 20:62911352-62911374 TTGCGCGGCGCCGCGGCAGGAGG - Exonic
1176291550 21:5048043-5048065 CTGAGTGGCCCCGAGGCGGCCGG - Intergenic
1176291559 21:5048078-5048100 CTGAGTGGCCCCGAGGCGGCCGG - Intergenic
1176291568 21:5048113-5048135 GTGAGTGGCCCCGAGGCGGCCGG - Intergenic
1176291578 21:5048148-5048170 CTGAGTGGCCCCGAGGCGGCCGG - Intergenic
1176291587 21:5048183-5048205 GTGAGTCGCCCCGAGGCGGCCGG - Intergenic
1179495173 21:41766826-41766848 GGGCGGGGCGCTGGGGCGGCTGG - Intronic
1179865668 21:44215458-44215480 GTGAGTCGCCCCGAGGCGGCCGG + Intergenic
1179865677 21:44215493-44215515 CTGAGTGGCCCCGAGGCGGCCGG + Intergenic
1179865687 21:44215528-44215550 GTGAGTGGCCCCGAGGCGGCCGG + Intergenic
1179865696 21:44215563-44215585 CTGAGTGGCCCCGAGGCGGCCGG + Intergenic
1179865705 21:44215598-44215620 CTGAGTGGCCCCGAGGCGGCCGG + Intergenic
1179951193 21:44709608-44709630 CGGCGTGGAGCCGCGGCGGGTGG - Intronic
1180042858 21:45288711-45288733 CTGCGGGGAGCGGCGGCGGCGGG - Intergenic
1181567894 22:23750958-23750980 GTGAGTGGCCCCGCGTCCGCCGG - Exonic
1182619977 22:31613624-31613646 GAGCGTGGCACAGCGGCGGACGG - Exonic
1182903941 22:33920700-33920722 GTGCGGGGAGCCGAGGCGGGCGG + Intronic
1183093687 22:35540324-35540346 GCGCGTGGGGCCGGGGCCGCTGG - Intergenic
1184222737 22:43111080-43111102 CTGCGTCTCGCCGCGACGGCTGG + Intronic
1184523757 22:45009730-45009752 GGGCTCGGCGCCGCGGCGCCCGG - Intronic
1184537067 22:45094492-45094514 CTGCGTGGCGCTGTGGCCGCGGG - Intergenic
1184766998 22:46577239-46577261 GAGGGGGGCGCCGCGGCGGGTGG + Intronic
1185255109 22:49827497-49827519 CTTCGGGGCGCCGCGGCCGCGGG + Intronic
1185272696 22:49936096-49936118 GAGCGCGGGGCCGGGGCGGCGGG - Intergenic
958732307 3:97972415-97972437 CTGCGTTGCGGCGCAGCGGCTGG + Exonic
960896760 3:122514425-122514447 CTGCGGGGCGCCGAGGCAGCGGG - Intronic
962263167 3:133927677-133927699 GGGCGTGGCGCCTCCGCGGGTGG + Intergenic
962301819 3:134250400-134250422 GTGAGTGGGGCCGCCGAGGCCGG - Intronic
964344661 3:155744225-155744247 GAGCGTGCCGCCGCGGGGCCGGG + Intronic
967930450 3:194686862-194686884 GGCCGAGGCGCCGCCGCGGCAGG + Exonic
968512957 4:1003348-1003370 GGGCGGGGCGCCGCGGCCACCGG - Exonic
968582479 4:1401529-1401551 GGGCGGGGCGCAGGGGCGGCTGG - Intergenic
968601880 4:1513373-1513395 GTGCGCGGCGCCGGAGCCGCTGG + Intergenic
969021761 4:4143796-4143818 GTGCGGGGCGAGGCGGCCGCGGG - Intergenic
969379111 4:6782810-6782832 CTGCCGGGCGGCGCGGCGGCCGG - Exonic
969791702 4:9497704-9497726 GTGCGGGGCGAGGCGGCCGCGGG + Intergenic
973551271 4:52038200-52038222 GTGAGTACCGCCGCGGCCGCGGG - Intronic
975420523 4:74158375-74158397 GTGGGCGGCCGCGCGGCGGCGGG + Intronic
975710591 4:77157286-77157308 CGGCGTTGCGCCGCGGCGGAGGG + Exonic
983576807 4:169270235-169270257 GTGCTTGGCGCCGTGGGAGCGGG - Intronic
985550140 5:528661-528683 GCGCGGGGCGGGGCGGCGGCCGG - Intergenic
986695787 5:10353655-10353677 GGGCGGGGCGCCGAGGCGGAAGG - Intergenic
987193256 5:15500403-15500425 GTGCGCGGCGCTGCGCCCGCCGG + Exonic
988734655 5:34008112-34008134 GGGCGCGGCGCCGCGGCTGGGGG - Intronic
990753113 5:59039417-59039439 GGGCGTGGGGCCGCGGCTCCGGG - Intronic
995224918 5:109690634-109690656 GGGTGTGGGGCCGCGGCGGGAGG - Intronic
1002006359 5:176238181-176238203 GTGCGAGACGCCGAGGCCGCGGG - Intergenic
1002220018 5:177672455-177672477 GTGCGAGACGCCGAGGCCGCGGG + Intergenic
1002692433 5:181059580-181059602 GCGCGTGCCCCCGCGGCGCCTGG + Exonic
1004216670 6:13710863-13710885 GAGAGCGGCGCAGCGGCGGCCGG + Intronic
1005968386 6:30742892-30742914 GAGCGTGGCGCGGCGTGGGCGGG - Intergenic
1006304108 6:33208601-33208623 GGGAGAGGCGCGGCGGCGGCGGG + Exonic
1006725412 6:36196549-36196571 GTGCCTGGCGCGGCGGCGGCCGG - Intergenic
1006851629 6:37102768-37102790 GGGCGAGGGGCCGGGGCGGCCGG - Intergenic
1014205541 6:118651668-118651690 GTGCGCGGCGCCGCGCGGGGCGG + Intronic
1018968439 6:168507583-168507605 GTGGGGGGCGCCCCGGGGGCAGG - Intronic
1019446345 7:1073667-1073689 GTGGGGGGCGTCACGGCGGCGGG - Intronic
1019562565 7:1665874-1665896 GAGCGCGGGGCGGCGGCGGCGGG - Intergenic
1020212118 7:6165250-6165272 GTGAGTGGGGCCTCGGGGGCGGG - Intronic
1020263614 7:6545837-6545859 GTGCGTGGGGAGGGGGCGGCTGG - Intronic
1020309179 7:6855826-6855848 GTGCGGGGCGAGGCGGCCGCGGG - Intergenic
1022739740 7:33109497-33109519 GTGAGTTGCGGGGCGGCGGCGGG - Intergenic
1023831459 7:44040928-44040950 GTGCGGGGCGCAGCGGCAGCGGG - Intergenic
1025320142 7:58087058-58087080 GGGCAAGGAGCCGCGGCGGCGGG - Intergenic
1026765056 7:73155089-73155111 GCGCGGGGGGCGGCGGCGGCCGG - Intergenic
1027041529 7:74964844-74964866 GCGCGGGGGGCGGCGGCGGCCGG - Exonic
1027082113 7:75237525-75237547 GCGCGGGGGGCGGCGGCGGCCGG + Intergenic
1028762337 7:94509914-94509936 GTCGGGGGCGCCGCGGCCGCGGG + Exonic
1029118807 7:98252529-98252551 GTGCGTGGCTGTGCGGCGTCAGG + Intronic
1029390694 7:100272071-100272093 GCGCGGGGGGCGGCGGCGGCCGG + Exonic
1029856442 7:103522044-103522066 GTGTGTGGAGCCGTGGCGTCGGG - Exonic
1031317294 7:120273423-120273445 GTGCGGGGCTGCGGGGCGGCGGG - Intergenic
1033300018 7:140177054-140177076 GCGCGCGAGGCCGCGGCGGCTGG + Intergenic
1034147115 7:148883766-148883788 TTGTGTGGCGCGGCCGCGGCGGG - Intronic
1034306203 7:150047395-150047417 GTGTCTGCAGCCGCGGCGGCCGG - Intergenic
1034448115 7:151123661-151123683 GTGGGTCGGGCCGGGGCGGCGGG - Intronic
1034455502 7:151167818-151167840 GAGCCGGGCGCGGCGGCGGCGGG - Intronic
1034800641 7:154053256-154053278 GTGTCTGCAGCCGCGGCGGCCGG + Intronic
1034911672 7:155002987-155003009 GCGCCGGGCGCCGCGGGGGCCGG - Exonic
1036739404 8:11347551-11347573 CCGCGTGGCGCCGCGGGGGGCGG - Intergenic
1038176373 8:25184830-25184852 GAGCGCGGGGCGGCGGCGGCCGG + Intronic
1038963496 8:32548072-32548094 GGGGGTGGCGGCGCGGCTGCCGG - Intronic
1039921395 8:41896593-41896615 GTTCGTGGCGCCCCGAGGGCCGG + Exonic
1041919873 8:63169087-63169109 GGGCGCGGTGCCGCGGCGGGTGG + Intronic
1042903161 8:73747453-73747475 GTGCGTTGCACAGCGGCGGCCGG - Intronic
1045305040 8:100951368-100951390 GCGCTGGGCGCTGCGGCGGCGGG - Intronic
1045305205 8:100951897-100951919 AAGCGAGGCGCGGCGGCGGCCGG + Intronic
1049218302 8:141417702-141417724 GTGCGGGGCGCGGCGAGGGCCGG - Intronic
1049645333 8:143733518-143733540 GTGCGCGGGGCCGGGGTGGCGGG - Intronic
1049801125 8:144517961-144517983 TCGCGGGGCGCCGCGGCGCCGGG + Intergenic
1050537764 9:6645394-6645416 GTGCTGGGCGCCGCGGAGCCGGG - Exonic
1053003311 9:34589660-34589682 GAGCCTCGCGCCGCGCCGGCTGG + Exonic
1057922035 9:99105303-99105325 GTGAGCGGCGGCGCGGCGGGCGG + Intronic
1060856044 9:126915297-126915319 GGGCGGGGCGCCGCGGCTGCAGG + Intronic
1061975928 9:134068053-134068075 ATGCGCTGCGCCGCGGCGCCTGG + Intronic
1061975960 9:134068155-134068177 GGGCGGGGCGCGGCGCCGGCGGG - Intronic
1062500120 9:136848657-136848679 GCGCGGGGCGCGGCGGCGGGTGG - Exonic
1062549431 9:137079156-137079178 GTGCGGGGCGCCGCGCAGTCGGG - Intronic
1185621341 X:1452933-1452955 GGGCGTGGCCTCGCGGAGGCGGG - Intronic
1185621351 X:1452959-1452981 GGGCGTGGCCTCGCGGAGGCGGG - Intronic
1189328046 X:40125014-40125036 GTGTGTGGCGTCGGGGGGGCGGG + Intronic
1190024585 X:46912256-46912278 GGGCGGGGCGTCGAGGCGGCGGG + Intronic
1190285224 X:48957203-48957225 GCGCTGGGCGCAGCGGCGGCGGG - Exonic
1197782444 X:130171686-130171708 GGCCGAGGCGCGGCGGCGGCTGG + Exonic