ID: 1157465302

View in Genome Browser
Species Human (GRCh38)
Location 18:47938882-47938904
Sequence CTGGTGCCTCAAAGACAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157465302_1157465306 22 Left 1157465302 18:47938882-47938904 CCATGTTGTCTTTGAGGCACCAG No data
Right 1157465306 18:47938927-47938949 ACCACTTCATACCCACTAAGAGG No data
1157465302_1157465308 23 Left 1157465302 18:47938882-47938904 CCATGTTGTCTTTGAGGCACCAG No data
Right 1157465308 18:47938928-47938950 CCACTTCATACCCACTAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157465302 Original CRISPR CTGGTGCCTCAAAGACAACA TGG (reversed) Intergenic
No off target data available for this crispr