ID: 1157465302 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:47938882-47938904 |
| Sequence | CTGGTGCCTCAAAGACAACA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1157465302_1157465306 | 22 | Left | 1157465302 | 18:47938882-47938904 | CCATGTTGTCTTTGAGGCACCAG | No data | ||
| Right | 1157465306 | 18:47938927-47938949 | ACCACTTCATACCCACTAAGAGG | No data | ||||
| 1157465302_1157465308 | 23 | Left | 1157465302 | 18:47938882-47938904 | CCATGTTGTCTTTGAGGCACCAG | No data | ||
| Right | 1157465308 | 18:47938928-47938950 | CCACTTCATACCCACTAAGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1157465302 | Original CRISPR | CTGGTGCCTCAAAGACAACA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||