ID: 1157466698

View in Genome Browser
Species Human (GRCh38)
Location 18:47953536-47953558
Sequence CTCAATGCACAGATGGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157466698_1157466708 22 Left 1157466698 18:47953536-47953558 CCCAGCACCATCTGTGCATTGAG No data
Right 1157466708 18:47953581-47953603 ATTCACTGGAACCTGGCAAAGGG No data
1157466698_1157466701 -3 Left 1157466698 18:47953536-47953558 CCCAGCACCATCTGTGCATTGAG No data
Right 1157466701 18:47953556-47953578 GAGCCGTGCCCAGAGTGATTTGG No data
1157466698_1157466709 27 Left 1157466698 18:47953536-47953558 CCCAGCACCATCTGTGCATTGAG No data
Right 1157466709 18:47953586-47953608 CTGGAACCTGGCAAAGGGTCTGG No data
1157466698_1157466706 15 Left 1157466698 18:47953536-47953558 CCCAGCACCATCTGTGCATTGAG No data
Right 1157466706 18:47953574-47953596 TTTGGTGATTCACTGGAACCTGG No data
1157466698_1157466707 21 Left 1157466698 18:47953536-47953558 CCCAGCACCATCTGTGCATTGAG No data
Right 1157466707 18:47953580-47953602 GATTCACTGGAACCTGGCAAAGG No data
1157466698_1157466705 8 Left 1157466698 18:47953536-47953558 CCCAGCACCATCTGTGCATTGAG No data
Right 1157466705 18:47953567-47953589 AGAGTGATTTGGTGATTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157466698 Original CRISPR CTCAATGCACAGATGGTGCT GGG (reversed) Intergenic
No off target data available for this crispr