ID: 1157467038

View in Genome Browser
Species Human (GRCh38)
Location 18:47956227-47956249
Sequence TAGCCACTGGTCCCCTGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157467038_1157467042 -10 Left 1157467038 18:47956227-47956249 CCTGTCCAGGGGACCAGTGGCTA No data
Right 1157467042 18:47956240-47956262 CCAGTGGCTATCCTTAGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157467038 Original CRISPR TAGCCACTGGTCCCCTGGAC AGG (reversed) Intergenic
No off target data available for this crispr