ID: 1157468603

View in Genome Browser
Species Human (GRCh38)
Location 18:47969910-47969932
Sequence TACAATCATGAACATGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157468603_1157468607 12 Left 1157468603 18:47969910-47969932 CCATGCCCATGTTCATGATTGTA No data
Right 1157468607 18:47969945-47969967 TTACATTAAAATAAACATTTAGG No data
1157468603_1157468608 21 Left 1157468603 18:47969910-47969932 CCATGCCCATGTTCATGATTGTA No data
Right 1157468608 18:47969954-47969976 AATAAACATTTAGGATATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157468603 Original CRISPR TACAATCATGAACATGGGCA TGG (reversed) Intergenic
No off target data available for this crispr