ID: 1157469673

View in Genome Browser
Species Human (GRCh38)
Location 18:47979587-47979609
Sequence CTGTCTCAAGGGCTGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157469673_1157469684 9 Left 1157469673 18:47979587-47979609 CCCTCTGCCAGCCCTTGAGACAG No data
Right 1157469684 18:47979619-47979641 GGTGTCTGTCACAGCCACAGAGG No data
1157469673_1157469687 23 Left 1157469673 18:47979587-47979609 CCCTCTGCCAGCCCTTGAGACAG No data
Right 1157469687 18:47979633-47979655 CCACAGAGGGTCCTTGTTTCTGG No data
1157469673_1157469688 24 Left 1157469673 18:47979587-47979609 CCCTCTGCCAGCCCTTGAGACAG No data
Right 1157469688 18:47979634-47979656 CACAGAGGGTCCTTGTTTCTGGG No data
1157469673_1157469685 10 Left 1157469673 18:47979587-47979609 CCCTCTGCCAGCCCTTGAGACAG No data
Right 1157469685 18:47979620-47979642 GTGTCTGTCACAGCCACAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157469673 Original CRISPR CTGTCTCAAGGGCTGGCAGA GGG (reversed) Intergenic
No off target data available for this crispr