ID: 1157480313

View in Genome Browser
Species Human (GRCh38)
Location 18:48049876-48049898
Sequence TGCCCTGGGGATTTGGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 1, 2: 1, 3: 30, 4: 307}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157480313_1157480323 12 Left 1157480313 18:48049876-48049898 CCATCTGCCAAATCCCCAGGGCA 0: 1
1: 1
2: 1
3: 30
4: 307
Right 1157480323 18:48049911-48049933 CCAGCCGACTCCCACTATCCCGG 0: 1
1: 0
2: 0
3: 3
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157480313 Original CRISPR TGCCCTGGGGATTTGGCAGA TGG (reversed) Intronic
900458286 1:2787759-2787781 TGCCCAGGTGATTGGGCAGTGGG + Intronic
900549326 1:3246283-3246305 TGCCCTGGGCACTTGGAAGTAGG - Intronic
900751463 1:4400575-4400597 TGCTCTTGGGATAAGGCAGAGGG - Intergenic
902294774 1:15459536-15459558 TTCCCTGAGAATTTGGAAGAAGG + Intronic
902374993 1:16026427-16026449 AGCCCTGGGGGTTGGGGAGATGG + Intronic
902628648 1:17691473-17691495 TGCCCTGGGGGTCTTGGAGAGGG + Intronic
902707146 1:18213450-18213472 GGCTCTGAGGACTTGGCAGAGGG - Intronic
903196159 1:21689864-21689886 TGCCTTGGGTCTTTAGCAGAGGG - Intronic
904371300 1:30049113-30049135 TGGCCTGGGGATTGGGGAGGTGG - Intergenic
905526158 1:38641639-38641661 TGCCCTTGCGATAAGGCAGAGGG - Intergenic
907391234 1:54159941-54159963 TGACCTGGGGGTGTGGCAGAGGG + Intronic
908269921 1:62412480-62412502 TGCCCTTGTGATAAGGCAGAGGG + Intergenic
908949281 1:69540087-69540109 TGCCCTGTGGGTTTAGCAGGTGG + Intergenic
909895027 1:81058052-81058074 TGCACTGGGGATTAGGGTGAGGG - Intergenic
909931494 1:81503855-81503877 GGCCCTGGGGTCATGGCAGAAGG - Intronic
910492522 1:87788127-87788149 TGTCCTGTGGGTTTGGCAGAGGG - Intergenic
912493875 1:110078792-110078814 TGGCCTGGGGCGTTGGCACAGGG + Intergenic
913595441 1:120371622-120371644 TTCCATGTGGATTTGGCTGACGG + Intergenic
914091833 1:144507353-144507375 TTCCATGTGGATTTGGCTGACGG - Intergenic
914306706 1:146426511-146426533 TTCCATGTGGATTTGGCTGACGG + Intergenic
914595343 1:149146291-149146313 TTCCATGTGGATTTGGCTGACGG - Intergenic
916424693 1:164669411-164669433 TCCTCTGTGGATTTGGGAGAGGG - Intronic
920035959 1:203065522-203065544 TCTCCTGGGGATGGGGCAGAGGG - Intronic
921053867 1:211529643-211529665 TGTCTGGGGGTTTTGGCAGAAGG - Intergenic
921130894 1:212218761-212218783 TGCCATGGAGATTGGGAAGAAGG + Intergenic
921422102 1:214960163-214960185 TGTTTTGGGGAATTGGCAGATGG + Intergenic
922602022 1:226863688-226863710 TGCACTGGGGCTGTGGCTGAGGG - Intergenic
924260883 1:242229963-242229985 TCCCCTGGGGATGGGGCAGTGGG - Intronic
1064159124 10:12928869-12928891 TCCCCTGGGTATGTGTCAGAGGG - Intronic
1065845384 10:29738759-29738781 TGACATGGGGAGTAGGCAGAGGG - Intergenic
1066649194 10:37639338-37639360 TGCCCTGGGGACTCTGCAGAGGG + Intergenic
1067032059 10:42884744-42884766 TGCCCTGGGGACTCTGCGGAGGG + Intergenic
1067660920 10:48235682-48235704 AGCCCTGGGGGTTGGGGAGATGG + Intronic
1067844771 10:49710871-49710893 AGCCCTGGGGAATGGGGAGAAGG - Intergenic
1069421855 10:68253623-68253645 AGCCCTAGAGAGTTGGCAGATGG - Intergenic
1069859444 10:71461309-71461331 TCCCCTGGGGACTTGGCATGGGG + Intronic
1070855227 10:79603266-79603288 TGCCCTTAGGATAAGGCAGAGGG - Intergenic
1071131512 10:82398826-82398848 TGCCCTGGAAATGAGGCAGAAGG + Intronic
1071328666 10:84540610-84540632 TTCCCTGGGGTCTTGGCAGCTGG + Intergenic
1071437629 10:85662010-85662032 TGCCCTGTGAACATGGCAGAAGG - Intronic
1073232829 10:101986905-101986927 TGCCCTGGGGTTAGGGAAGATGG - Intronic
1073323967 10:102631929-102631951 TGCCCTGAGGACTTACCAGAGGG + Exonic
1074786850 10:116849271-116849293 TTCCCTGGCGATTTTCCAGAGGG - Intergenic
1074820534 10:117175067-117175089 AGCCCTGAGGATTTTGCGGAAGG + Intergenic
1074965450 10:118487272-118487294 TGCCCTTGCGATAAGGCAGAGGG - Intergenic
1075733962 10:124652843-124652865 TGCCCTGGGGACTAGCCTGAGGG - Intronic
1076985405 11:232526-232548 TAATCTGGGGATTTGGAAGAAGG + Intronic
1077308990 11:1880271-1880293 TACCCTGGGGCCTGGGCAGAGGG + Intronic
1077386158 11:2270449-2270471 TGCCCTGGGGAGTTGCCTGGCGG - Exonic
1077521703 11:3039585-3039607 AGCCCTGGGTGTTTTGCAGAAGG - Intronic
1078442606 11:11379725-11379747 TGGGCTGGGGTCTTGGCAGAGGG - Intronic
1081075437 11:38667659-38667681 TGCCCTTGAGATAAGGCAGAGGG - Intergenic
1081599606 11:44484107-44484129 TGCCCTGGGGCCTTGGCAGAGGG - Intergenic
1081924739 11:46815952-46815974 TGCCCTGCTGATCTGGCAGGAGG - Intronic
1083880968 11:65548089-65548111 TGCCCTGGGGATATGGCAGAAGG - Intronic
1084083569 11:66844325-66844347 TGCCCTTGTGACCTGGCAGATGG + Exonic
1084406182 11:68974941-68974963 GGCCATGAGGATCTGGCAGAGGG + Intergenic
1084423442 11:69071833-69071855 TCCCCTGGGGAACAGGCAGAGGG - Intronic
1084647114 11:70464992-70465014 TGCCCTGGGGATGTGGGAGGGGG + Intergenic
1085294160 11:75421266-75421288 GGCCCTGGGGCTTTGGAAGATGG + Intronic
1087139986 11:94755871-94755893 TGTCCTTGGGATAAGGCAGAGGG - Intronic
1089151179 11:116365636-116365658 GGACCTGGAGATTGGGCAGAAGG - Intergenic
1091063407 11:132486206-132486228 TGCTGTGGGGATTCTGCAGAGGG + Intronic
1092075195 12:5666837-5666859 TGCCTTGGGGCTTTGGCCGTTGG + Intronic
1092124712 12:6066939-6066961 TGTCCTGGGGACCAGGCAGAGGG - Intronic
1093683562 12:22030652-22030674 TGCCCTTGTGATAAGGCAGAAGG + Intergenic
1095207128 12:39450966-39450988 TGCAATGGAGATTTGGCAGAAGG - Intergenic
1096257500 12:50072359-50072381 GGCCCTGGAGACTTGGCTGATGG + Intronic
1096764536 12:53872987-53873009 TCCCTTGGAGATGTGGCAGAGGG - Intergenic
1097697417 12:62787883-62787905 TGCCCTGGGTGTTTGGAAGGGGG - Intronic
1098244716 12:68504507-68504529 TTGCCTGGGGATGGGGCAGAAGG - Intergenic
1098393165 12:69990896-69990918 TGCCCTGGGGATGTGGAAACAGG + Intergenic
1101569021 12:105936152-105936174 TGCCCTGTGGAGTTCACAGAAGG - Intergenic
1102886364 12:116525115-116525137 TGCCCCAGGAATTTGGGAGAGGG + Intergenic
1103735858 12:123060466-123060488 GGCGCTGGGGGCTTGGCAGAGGG - Intronic
1103894093 12:124261877-124261899 TGGCCTGGGGATCAGGCAGTGGG + Intronic
1103985526 12:124764877-124764899 AGCCTTGGAGATTAGGCAGATGG - Intergenic
1105620486 13:22061368-22061390 GCCCCTGGGGGGTTGGCAGAAGG - Intergenic
1106498251 13:30302485-30302507 TTTCCTGGTGATTTGGCAGTAGG - Intronic
1106633741 13:31505138-31505160 TGCGGTGGGTATTTGGCACAAGG + Intergenic
1107518567 13:41156772-41156794 TGCCCTGGGCAATTGTCAGCTGG + Intergenic
1107624764 13:42271684-42271706 AGGCCTGGGGACTTGCCAGAGGG + Intergenic
1107959067 13:45543020-45543042 TCCCCTGGGAATGAGGCAGATGG - Intronic
1108116639 13:47135981-47136003 TGCCCAGGGCAATGGGCAGATGG - Intergenic
1108405678 13:50099634-50099656 AGCCTTGGGGATTTGGCTGCAGG - Intronic
1109897740 13:68715834-68715856 TGCCCAGGGGATGTGGCTGCTGG + Intergenic
1111325307 13:86686560-86686582 TGCCATTGGGCTTTGGGAGAAGG + Intergenic
1111405061 13:87793247-87793269 TGCCCTTGTGATAAGGCAGAGGG - Intergenic
1111681785 13:91451407-91451429 GGGTCTGGGGATTTAGCAGAGGG + Intronic
1112955804 13:105056729-105056751 AGCCCTGGGGATTGGGTGGATGG - Intergenic
1113923783 13:113929264-113929286 AGCCCTGAGGAGGTGGCAGACGG - Intergenic
1115367055 14:32570065-32570087 TGCTCTGGGCATTTAGAAGAGGG - Intronic
1115508961 14:34120961-34120983 TGCCATGGGGACTTGGCTAAAGG - Intronic
1116283751 14:42945656-42945678 TACCCTGTGGAATTGTCAGATGG + Intergenic
1119104763 14:71913474-71913496 TGGGCTGGGGATTTGGCTAAGGG + Intergenic
1119615011 14:76093142-76093164 TGCCCTGGGGTCTTGGCTGAGGG - Intergenic
1119615163 14:76094226-76094248 TGGCCTGGGGTCTTGGCTGAGGG - Intergenic
1119892612 14:78194306-78194328 TGCCCAGGAGAGTTGGGAGAAGG + Intergenic
1120126066 14:80744888-80744910 TGACCTGGGGAAATGGCAGTTGG - Intronic
1120898619 14:89556827-89556849 TGCCCTGCTGATTTGGGAAAGGG + Intronic
1122084718 14:99291568-99291590 TGGCCTGGGGAGGTGGCAGTAGG - Intergenic
1122126088 14:99579501-99579523 TGCCCTGGGATCTGGGCAGAAGG - Intronic
1122142822 14:99672975-99672997 TGCCCTGGGGATACAGCACACGG + Intronic
1124597349 15:31102084-31102106 TGCCCCGGGGAGCTGGGAGAAGG + Intronic
1125239598 15:37558580-37558602 TTCACTGGGGCATTGGCAGAAGG - Intergenic
1126097961 15:45102430-45102452 TGCCCCGGGGTGTTGGCACAAGG - Intronic
1126121922 15:45261022-45261044 TGCCCTGGGGCTTTGGCCCATGG - Intronic
1127529987 15:59834372-59834394 CCCTCTGGGGATTTGGCAGCAGG - Intergenic
1128729897 15:70014075-70014097 TGCCCTGTGGATTTGTCAGGAGG - Intergenic
1129150844 15:73686959-73686981 TGCCCTGGGGATGTGGGAAAAGG - Intronic
1129295155 15:74596160-74596182 GGCCCTGGGGTCATGGCAGAAGG - Exonic
1129361961 15:75029819-75029841 TGCCCTGGGGCTATGGGAAAAGG - Intronic
1130073780 15:80671209-80671231 TGCCCTTGTGATAAGGCAGAGGG + Intergenic
1130205297 15:81869920-81869942 GGCCCTGTGGCTTTGGCAGTGGG - Intergenic
1130966803 15:88703772-88703794 TGGCCAGGGGATGTGGGAGATGG - Intergenic
1131173316 15:90193461-90193483 GGCAGTGGGGATTTGGAAGATGG + Intronic
1131350651 15:91696899-91696921 TGCCCTGGGGAGATGGGAAATGG - Intergenic
1132128746 15:99253797-99253819 TGGCTTGTGGTTTTGGCAGATGG + Intronic
1133048246 16:3101101-3101123 TGCCCTGGGCATTGGGGACAAGG + Intergenic
1133777166 16:8905912-8905934 TGCCAAGGGGATTTGGTGGAGGG - Intronic
1135927291 16:26706779-26706801 TGCCCTGGGGCCTTGGCACTGGG + Intergenic
1136004027 16:27315992-27316014 TGCCCTGGGCATTTTGCAACCGG - Intronic
1138150068 16:54648711-54648733 TCTCCTGGGGATTTGCCAGCTGG - Intergenic
1138605196 16:58084049-58084071 TGCCCTGGGGAGTTGACACTTGG - Intergenic
1138917565 16:61485472-61485494 TGTCCTGGGGTGTTGGGAGAGGG + Intergenic
1139285963 16:65814297-65814319 TGCACTGAGTATTTGGGAGATGG - Intergenic
1140508309 16:75488583-75488605 AGCCCTGGGCATTTGGAAGGGGG + Intronic
1141471653 16:84242769-84242791 TGCCCTGGGGAAAGGGCTGACGG - Intergenic
1141655607 16:85414561-85414583 TGCCCTGGGGCTTTGGAGAAGGG + Intergenic
1142108147 16:88317300-88317322 TGCCCTGGGGAGAAGGCAGAAGG - Intergenic
1142225536 16:88875472-88875494 TTCCCTGGGGAGGAGGCAGAGGG + Exonic
1142258972 16:89033567-89033589 TGCCCTGAGGATTTGGGGCAAGG + Intergenic
1143076857 17:4351461-4351483 TGCCCTGAGCATTTGCCAAATGG - Intronic
1143494007 17:7300575-7300597 TGACTTGGGCATCTGGCAGAAGG - Intergenic
1143701636 17:8664999-8665021 TGCCCTCTGGGTTTGGCAGGAGG + Intergenic
1143830687 17:9648102-9648124 GGCCCTGGGGATTTGACAGCGGG - Intronic
1144320815 17:14117784-14117806 TGTCCTTGGGATAAGGCAGAAGG - Intronic
1144413604 17:15024392-15024414 TACCCAGGTGATTTGGCAGGAGG - Intergenic
1145056478 17:19706884-19706906 GGCACTGGGCATTTTGCAGAGGG + Intronic
1149234598 17:54575127-54575149 TGCCCTAGGGAGATAGCAGAGGG - Intergenic
1149325951 17:55530145-55530167 CTCCATGGGGATTTGGCAAAAGG + Intergenic
1149495217 17:57113155-57113177 TGCCCCAGGAGTTTGGCAGAGGG + Intronic
1149815895 17:59723485-59723507 TGTCCTTTGGATTTGGCAAATGG + Intronic
1149985891 17:61346812-61346834 TGCTGTGGGGATGTGGTAGAGGG + Intronic
1150657133 17:67046638-67046660 TGCCCAGGGGAGTTGGCTGGAGG - Intronic
1150682041 17:67292158-67292180 TGCCCCGGAGCTTTGGGAGAGGG + Intergenic
1151819629 17:76490541-76490563 TGCCCTGGGGAACTGGCACTGGG + Intronic
1152401661 17:80070181-80070203 TAGCCTGGGGATCTGGCAGGTGG + Intronic
1152848775 17:82618964-82618986 GGCCTTTGGGATTTGGGAGAGGG - Intronic
1153764506 18:8362579-8362601 AGACTTGGGGAGTTGGCAGAGGG - Intronic
1155147353 18:23095151-23095173 TGCTCTGTGTTTTTGGCAGAAGG - Intergenic
1155637877 18:27976457-27976479 TGCCATGCGAATTTGTCAGAAGG - Intronic
1155680083 18:28477280-28477302 TCCCCTGGGGTTTTGGCATTTGG + Intergenic
1156528262 18:37789305-37789327 GGCCTGGGGGATTTGGCTGAAGG + Intergenic
1157480313 18:48049876-48049898 TGCCCTGGGGATTTGGCAGATGG - Intronic
1157551598 18:48585580-48585602 TCCCCTGGAGACTTGGCAGGTGG + Intronic
1157855430 18:51100623-51100645 TGCCCTTGCGATAAGGCAGAGGG + Intergenic
1157873213 18:51248902-51248924 TGCTCTGGGGAGTGGCCAGAAGG - Intergenic
1158582530 18:58697067-58697089 TGCACTGGGGATTTCTCAGTGGG + Intronic
1160120536 18:76126634-76126656 TGCCCTGAGGATTTTGGATACGG + Intergenic
1160269247 18:77369112-77369134 TGGCAGGGGGACTTGGCAGATGG - Intergenic
1163798749 19:19352580-19352602 TGGCCTGGGGGTGTGTCAGATGG + Intronic
1163807346 19:19406894-19406916 TGCCCTGAGAATTTTGCACAGGG + Intronic
1163809019 19:19418856-19418878 AGCCCTGGGGATTTGCCACTTGG + Intronic
1164336081 19:24322771-24322793 TTCCCTGGTGTTTTGGCAGGAGG - Intergenic
1164913000 19:32027391-32027413 TGCCCTTGGGCTTTGGGGGATGG + Intergenic
1165377120 19:35450553-35450575 TGCGCAGGGCATTTGGGAGAGGG + Exonic
1166089196 19:40497380-40497402 TGCCCAGGGCAATGGGCAGAAGG - Intronic
1166142001 19:40810275-40810297 TGTACTCGGGATTTGGCATAAGG + Intronic
1166185524 19:41136518-41136540 TGTACTCGGGATTTGGCATAAGG - Intergenic
925049158 2:797762-797784 TGCCCTTGTGATAAGGCAGAAGG - Intergenic
925244491 2:2368706-2368728 TGCCCTTTGGATTTTCCAGATGG - Intergenic
925604130 2:5640977-5640999 TTCCATGTGGATTTGGCTGACGG + Intergenic
925875139 2:8305008-8305030 TGCCTAGGGGATGTCGCAGAAGG - Intergenic
925955730 2:8962012-8962034 TGCTCTGGGGAGCTGGCAGAAGG - Intronic
926231521 2:11007781-11007803 TTGCCTGGGAATTGGGCAGAGGG - Intergenic
926582701 2:14648814-14648836 TGATGTGGTGATTTGGCAGATGG - Intronic
927137031 2:20104740-20104762 TGCTCTGAGGACTGGGCAGAGGG - Intergenic
927446185 2:23163957-23163979 TGCCCTGAGGAGTAGGAAGAGGG - Intergenic
927806720 2:26154142-26154164 TGCCATGGGGATTTTTGAGAGGG - Intergenic
930309038 2:49714468-49714490 TGTCCTTGTGATTAGGCAGAGGG + Intergenic
930884513 2:56309799-56309821 TGCTCTGGGGTTTTGGCAGCGGG + Intronic
931183763 2:59929840-59929862 TGCTCTGAGGATCTGGCAGGGGG + Intergenic
931717814 2:65043062-65043084 TCCCCTGGGGTGTTGTCAGAGGG + Intergenic
931784024 2:65602957-65602979 TGCCAAGGGGAATTGGCATAGGG + Intergenic
931822139 2:65962838-65962860 TGCCTTGGGGACTTGGCACAAGG - Intergenic
933120447 2:78529815-78529837 CTCCCTGGGGCTTTGGGAGAAGG - Intergenic
933449678 2:82431645-82431667 TGAATTGGGGATTTGGGAGACGG - Intergenic
933453546 2:82491266-82491288 TCCCCTGTCGATTTGGCAGAAGG + Intergenic
933729448 2:85446053-85446075 GGCCCTGGGAATTAGGCAGCAGG - Intergenic
942296963 2:174527282-174527304 GGCCCCAGGGATTTGGCCGAAGG + Intergenic
942402138 2:175614201-175614223 TGCCCTGGGATTCTGGCAGCTGG - Intergenic
944364951 2:198907333-198907355 TGCCCTGAGTATTTGGCACATGG - Intergenic
946091397 2:217227197-217227219 TGCCCTGGTTATTTGATAGATGG + Intergenic
946700639 2:222409735-222409757 TGTCATGGGGATTTGGCGTACGG + Intergenic
946797707 2:223373291-223373313 TACCCTGGGGATTCTGCAGGAGG + Intergenic
947045021 2:225972005-225972027 TGCCCTAAGGAGTTTGCAGAGGG + Intergenic
948051628 2:234983177-234983199 TGCCCTGGGTAATTGGCACCCGG - Intronic
949041936 2:241853508-241853530 TGCCCTGGGCAGTGGGCAGTGGG + Intronic
1168744969 20:231573-231595 TGCCATTGGGATTTGGAAGGGGG - Intergenic
1169282344 20:4278383-4278405 TCCCCTGGGGATAAGGCAGATGG - Intergenic
1170597304 20:17815810-17815832 TGCGCTGGGAATGTGCCAGAAGG + Intergenic
1170603599 20:17859873-17859895 AGCCCAGGGGAGTTGGCAGTGGG + Intergenic
1171072875 20:22092370-22092392 TGCCCTTGAGATAAGGCAGAGGG - Intergenic
1172092738 20:32445695-32445717 AGGCCTGGGGATTGGTCAGATGG + Exonic
1172177175 20:32979568-32979590 TCCCCTGGGGACTTGGGTGAGGG + Intergenic
1172321081 20:33995277-33995299 TTCCCTGGGGTTTTGGCTCAAGG + Intronic
1172656995 20:36543446-36543468 GGCCCGGGGGTTTGGGCAGAGGG + Intronic
1174547200 20:51334471-51334493 GGCACTGGGGATATGGCAGTTGG - Intergenic
1175213782 20:57378694-57378716 AGCACTGGGGATTTTGAAGATGG - Exonic
1175402551 20:58708742-58708764 GGCCCCGTGGCTTTGGCAGATGG + Intronic
1176970968 21:15265273-15265295 TCTCCTGGGGATTTGGCATTGGG - Intergenic
1178213761 21:30569361-30569383 TGCCCTTGTGATAAGGCAGAGGG + Intergenic
1178800741 21:35792928-35792950 TGCCCTGTGAAGGTGGCAGAAGG + Intronic
1178906396 21:36640712-36640734 TTCCCTGGCGATTTGGCAGTAGG + Intergenic
1179639971 21:42741182-42741204 TGCCCTGTGGATTTGCCACGTGG - Intronic
1180119366 21:45736576-45736598 TGGCATGGGGAGTTGGCAGGGGG + Intronic
1181257562 22:21573740-21573762 AGCACTGGGGAGTAGGCAGATGG - Intronic
1182228937 22:28821714-28821736 AGCCATGGGGATTTGCCAGCAGG - Intergenic
1182310862 22:29405515-29405537 TGCCCTGGAGAGGTGGCAGGTGG - Intronic
1182690189 22:32155243-32155265 TGCCCTGGAGAGATGGCAGGTGG + Intronic
1182821270 22:33218498-33218520 TGTTATGGGGATTTGGAAGAGGG - Intronic
1182867516 22:33617010-33617032 TGACCTGTGTATTTGGGAGAGGG + Intronic
1183949912 22:41347177-41347199 TGTCCTGGGGGTTTGGCTGTGGG - Intronic
1184271971 22:43389501-43389523 TGCCATGGTGATTTTCCAGATGG + Intergenic
1185157117 22:49199806-49199828 TGCCCTGGGAGTCGGGCAGAGGG + Intergenic
950569812 3:13793041-13793063 TGCCCTGGGCATGCGGCAGATGG + Intergenic
952315133 3:32225891-32225913 AGCCATGGGGATTTGGGAAAAGG - Intergenic
953457570 3:43055056-43055078 TGGCCTTGCGATTTAGCAGATGG + Intronic
953543617 3:43843842-43843864 ATCCCTGGGGGTGTGGCAGAAGG - Intergenic
954192245 3:48971861-48971883 TTCCCTGGGTATTTGCCTGAGGG + Intronic
954293048 3:49659849-49659871 AGCCCAGAGGGTTTGGCAGAGGG + Intronic
955661830 3:61307680-61307702 TTACCTGGGAATTTGCCAGAAGG + Intergenic
956202727 3:66722970-66722992 TGACCTGGGGAACTGGAAGAAGG + Intergenic
956388755 3:68749102-68749124 TACATTGGGGATTTGGGAGACGG - Intronic
956607663 3:71089262-71089284 TGCCCTTGTGATGTGGCAGCTGG - Intronic
956968279 3:74489632-74489654 AGGCCTGGGGATTAGGCGGAGGG - Intronic
957785085 3:84871992-84872014 TGTCCTGGGGATTGAACAGAAGG - Intergenic
958978839 3:100697215-100697237 TGCCCTGGCGATAAGGCAGAGGG + Intergenic
960699620 3:120427471-120427493 TGCCCTGGGGACTTGGGATAGGG + Intronic
960988117 3:123293411-123293433 TCCCCTGGGATTTTGGGAGAGGG - Intronic
966716421 3:183017574-183017596 TGACCAGTGCATTTGGCAGATGG - Intronic
968973946 4:3811412-3811434 TGGCCTGGGGCTTTGGCTGGAGG + Intergenic
969658363 4:8510762-8510784 TGCCCTGGGGCTCTAGCACATGG + Intergenic
969924170 4:10570106-10570128 TCCTTTGGGGATTTGACAGATGG + Intronic
972519203 4:39837931-39837953 AGCCCTGGGGGTTTGGAAGCAGG - Exonic
973221239 4:47730111-47730133 TGCCCTTGCGATAGGGCAGAGGG + Intronic
973570145 4:52230492-52230514 TGGCCTGTGCATTTGACAGATGG + Intergenic
974962804 4:68724712-68724734 TGCCCTTGAGATAAGGCAGAGGG - Intergenic
980438331 4:132809679-132809701 TGTCCTTGGGATAAGGCAGAGGG + Intergenic
980496857 4:133596737-133596759 TGCCCTCGTGATAAGGCAGAGGG - Intergenic
980731616 4:136831918-136831940 TGTCCTTGTGATATGGCAGAGGG - Intergenic
980985748 4:139692508-139692530 TGCTCTGGGTCTGTGGCAGAGGG + Intronic
982474656 4:155835124-155835146 TGCCCTTGCGATAAGGCAGAGGG + Intronic
983588540 4:169382602-169382624 TGCCCTTGCGATAAGGCAGAGGG - Intergenic
983942440 4:173549377-173549399 TGGCCCGGGGATTTAGGAGATGG + Intergenic
984034297 4:174647025-174647047 TCCCCTGTTGAATTGGCAGATGG + Intronic
985362256 4:189188233-189188255 TGTCCTGGGAAGGTGGCAGAAGG + Intergenic
985382728 4:189412569-189412591 TCCCCTGGTGCTGTGGCAGAAGG - Intergenic
985939327 5:3121826-3121848 TGCCCTGGGGATTCGCGAGGGGG + Intergenic
988038437 5:25858045-25858067 TGCCCTTGTGATAAGGCAGAGGG + Intergenic
988042876 5:25911174-25911196 TGCCCTGACGATCTGGCACAGGG - Intergenic
989491471 5:42060412-42060434 TGCCCTCGCGATAAGGCAGAGGG + Intergenic
990809456 5:59706143-59706165 TGCCCTGGGGATTGGCCATGTGG + Intronic
992210799 5:74477982-74478004 TGCCCTAGCGATAAGGCAGAGGG - Intergenic
992849932 5:80796986-80797008 TGCCTCTGGGACTTGGCAGATGG + Intronic
996397886 5:123031743-123031765 TGCACTGGGGTGGTGGCAGAAGG + Intronic
998675331 5:144401591-144401613 TTTCCTGGGCATTTTGCAGAAGG + Intronic
1001173050 5:169439657-169439679 TGTCCTTGGCATTTGTCAGAGGG - Intergenic
1001314369 5:170632098-170632120 TGGCCTGGGGACTGGGCAGGAGG - Intronic
1002424995 5:179169627-179169649 GGCCCTGGGGATCTGGGACAGGG - Intronic
1003167813 6:3696733-3696755 TGCCCTGGAGAATACGCAGATGG + Intergenic
1003534971 6:6968914-6968936 AGCCTTGGGGATTTGGGCGAAGG - Intergenic
1006109807 6:31737648-31737670 TGCCTTGGAGATGGGGCAGAGGG + Intronic
1006141154 6:31930731-31930753 TGCCCTTGGGTTTTGGCAAATGG + Intronic
1006218010 6:32462303-32462325 TTCCCTAGGGAGTTGGGAGAGGG + Intergenic
1006331170 6:33392023-33392045 TGCCCTGGGGATGGGGACGAAGG + Intronic
1007683702 6:43652000-43652022 TGCCCAGGGGATTTTTTAGAAGG - Intronic
1007942752 6:45797737-45797759 TGCACTGGTCATTTGGCAGAGGG - Intergenic
1009561600 6:65252182-65252204 TGCACAGGGGAGATGGCAGAGGG + Intronic
1013343345 6:109236666-109236688 TGCCCTTGTGATAAGGCAGAGGG - Intergenic
1014427827 6:121330688-121330710 TTCCTGGGGGTTTTGGCAGAGGG - Intronic
1014867541 6:126550706-126550728 TGCCCTTGCGATAAGGCAGAAGG - Intergenic
1015141773 6:129942191-129942213 TGGCCTGGGGATTGGAGAGATGG + Intergenic
1017948523 6:159116329-159116351 TGCCCTTGCGATAAGGCAGAGGG + Intergenic
1018997565 6:168721706-168721728 TGCCCTGGAGCCTTCGCAGAGGG + Intergenic
1019165154 6:170093770-170093792 TGCCTCGGGGATGAGGCAGACGG - Intergenic
1019356546 7:582842-582864 TGCGTTTGGGATTTTGCAGAGGG + Intronic
1021624753 7:22582091-22582113 GGCTCTGGGGATATGCCAGAAGG + Intronic
1022179412 7:27903949-27903971 AGCTGTGGGGAGTTGGCAGATGG + Intronic
1023875462 7:44284046-44284068 TGCCCTGTGGACTGGGCAGCAGG - Intronic
1025711324 7:63912543-63912565 TCTCCTGGGTTTTTGGCAGATGG + Intergenic
1029040468 7:97567633-97567655 TGACCTGGGGGTTTCTCAGAGGG - Intergenic
1030207665 7:106966658-106966680 TGCCCTTGTGATAAGGCAGAGGG - Intergenic
1030513581 7:110515337-110515359 TGCCCTTGTGATAAGGCAGAGGG - Intergenic
1030746583 7:113173179-113173201 TGTCCTGGTGATAAGGCAGAGGG + Intergenic
1032468896 7:132164100-132164122 TCCCCTGGGGCTTTGACAGGCGG - Intronic
1032482892 7:132261157-132261179 TGCCCAGGGGACATGGAAGAAGG + Intronic
1032768443 7:135023567-135023589 AGCCCAGGGGATTTTGCACATGG + Intronic
1033221303 7:139527683-139527705 TGGCCTGGGGGTATGGGAGAGGG + Intronic
1033356083 7:140601584-140601606 TTCTCCGGGGTTTTGGCAGAGGG + Exonic
1034265599 7:149779242-149779264 TGCCCTGAGGATCTGGGAGAGGG - Intergenic
1034763624 7:153696605-153696627 TGTCCTTGCGATTAGGCAGAGGG + Intergenic
1035231554 7:157468817-157468839 TGACCTGGGGACTTGGACGATGG + Intergenic
1035444629 7:158932018-158932040 GGCCCTGGGGAGTTGGCCGTGGG - Intronic
1036016992 8:4796272-4796294 TGGCCAGAGGATTTGGCAGAAGG + Intronic
1037555929 8:20022408-20022430 TGCCTTGGGAATTGGGCAGTAGG + Intergenic
1038048418 8:23786848-23786870 TGCTCTGGGGATCTAGGAGAAGG + Intergenic
1040602708 8:48899784-48899806 TGCCCTGGTGATCTAACAGAGGG - Intergenic
1041375234 8:57205324-57205346 AGCCCTGAGCATGTGGCAGAGGG + Intergenic
1041486232 8:58379761-58379783 TGCCCAGGGGAATTACCAGAAGG - Intergenic
1042064102 8:64855216-64855238 TGCCTTGGTAATTTGGGAGACGG - Intergenic
1045182960 8:99805972-99805994 TGCCCTGGGCTTCAGGCAGAAGG + Intronic
1046027649 8:108744864-108744886 TTCCCTGGGAATCTGGCTGATGG + Intronic
1046174657 8:110559898-110559920 TGCCCTTGTGATAAGGCAGATGG - Intergenic
1047586549 8:126279832-126279854 TGTCCTTGGGATAAGGCAGAGGG + Intergenic
1047900539 8:129416824-129416846 TGCACTGGGGAGATGGCAGAAGG + Intergenic
1047966071 8:130047775-130047797 TCCCCTGGCGGTTTTGCAGAAGG + Intergenic
1048399679 8:134052770-134052792 TGCCCTTCAGATTTGGCAGTGGG + Intergenic
1048531449 8:135253794-135253816 TGCCCTTGGAATAAGGCAGAGGG + Intergenic
1048899917 8:139027426-139027448 TGCCCTTGTGATAAGGCAGAGGG + Intergenic
1050253869 9:3773857-3773879 TGCCATTGGGATTTGGCACAGGG + Intergenic
1051144812 9:14015719-14015741 TGCCTTGGGGATTTTGCACTGGG + Intergenic
1053307283 9:36993871-36993893 AGCCCTGGGGGTATGGGAGAGGG - Intronic
1056247627 9:84712082-84712104 TGCCATGGGGATTTGGGAGCTGG - Intronic
1057282030 9:93720163-93720185 TGCCCTGGGGCTGTGGGAGGTGG - Intergenic
1059257336 9:112943303-112943325 TGAGCTGGTGATGTGGCAGAGGG + Intergenic
1059324684 9:113497094-113497116 GGCTGTGGGAATTTGGCAGAGGG + Intronic
1060245887 9:121945993-121946015 TGCCCTTGGCATTTGGCATGGGG - Intronic
1061290554 9:129648560-129648582 TGCCCTGGGGACTTGCCCGGGGG - Intergenic
1061872394 9:133527919-133527941 TGGCCTGGGGAGCTGGGAGAGGG + Intronic
1062401554 9:136375029-136375051 AGCCCTGGGCACCTGGCAGACGG - Intergenic
1186965428 X:14781720-14781742 GGCCATGGGGATATGGCACAAGG + Intergenic
1189319182 X:40077228-40077250 TATCCTGGGGATTTGGAAGTTGG - Intronic
1190260303 X:48793122-48793144 TGCCCTGGGGATGTGGAAGTGGG - Intronic
1194119493 X:89943151-89943173 TGCCCTTGCGATAAGGCAGAGGG + Intergenic
1196243435 X:113370195-113370217 TGCCCTTGCGATAAGGCAGAGGG - Intergenic
1197598087 X:128491303-128491325 TGCACTGGGTATTATGCAGAGGG + Intergenic
1199103924 X:143839240-143839262 GGCACTGGGGATCTGACAGATGG + Intergenic
1200472365 Y:3600708-3600730 TGCCCTTGCGATAAGGCAGAGGG + Intergenic