ID: 1157480702

View in Genome Browser
Species Human (GRCh38)
Location 18:48051779-48051801
Sequence GGCGGGACACACCAATGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 71}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157480702 Original CRISPR GGCGGGACACACCAATGGAG AGG Intronic
900693727 1:3997122-3997144 TGTGGGACAAAGCAATGGAGCGG + Intergenic
906479359 1:46190028-46190050 TGTGGGACACACCCATGAAGTGG - Intronic
907710132 1:56873082-56873104 GGCAGGACAGACCTATGGACAGG + Intronic
907759101 1:57340427-57340449 GCCATGACACACCAATGCAGAGG - Intronic
907834284 1:58094165-58094187 GGAGGGACAGAGCAATGGGGTGG - Intronic
915579361 1:156804261-156804283 GGGTGGACACACCAAAGGGGTGG - Intergenic
917966974 1:180185070-180185092 GGCAGGGCACAGGAATGGAGAGG + Intronic
919020533 1:192099631-192099653 GGAGGGACACACAAGTGGAATGG - Intergenic
920357573 1:205386102-205386124 GTCAGGACACAACAATAGAGTGG + Intronic
922900085 1:229129901-229129923 GGAGGGACGCACCCATGTAGGGG - Intergenic
1065789701 10:29249641-29249663 TGTGGGACCCATCAATGGAGAGG - Intergenic
1068802918 10:61162419-61162441 GGCAGGCCACAGAAATGGAGAGG + Intergenic
1070154751 10:73826472-73826494 GGAGGGGCACAGCAAGGGAGGGG + Intronic
1076007438 10:126959020-126959042 GGCGGGACATTCCAAAGCAGGGG + Intronic
1077211308 11:1372053-1372075 TGCGGGAGAGACCAAGGGAGCGG + Intergenic
1077870698 11:6259618-6259640 GACGGGACACATCTAGGGAGGGG + Intergenic
1084180084 11:67441781-67441803 GGAGGGGCACACCAAGCGAGTGG - Exonic
1094856017 12:34403175-34403197 GACGGGAAACACAAATGGCGTGG + Intergenic
1105913860 13:24894743-24894765 GGCGGGACACGGGGATGGAGTGG + Intronic
1108559379 13:51627805-51627827 GGGATGACCCACCAATGGAGAGG - Intronic
1113427783 13:110223821-110223843 GGCAGGACACACCAAGCAAGAGG + Intronic
1122627189 14:103090704-103090726 GGGGGGACACACCTGGGGAGGGG - Intergenic
1122987737 14:105220253-105220275 GGCGCGACCCACCAGTGCAGAGG - Intronic
1126738826 15:51757650-51757672 GGACAGACACACCACTGGAGGGG + Intronic
1132242036 15:100265564-100265586 GTAGGGACACAGCAAGGGAGGGG + Intronic
1133603783 16:7366197-7366219 GGCAGCAGACACCAATGGGGTGG - Intronic
1141697050 16:85625102-85625124 GGCACGACAGACCAAGGGAGAGG - Intronic
1146809397 17:35891186-35891208 GGGGGTATACACCAATAGAGGGG - Intergenic
1147555613 17:41477073-41477095 GGCAGGGCACACAAATGGGGCGG + Exonic
1156242457 18:35267319-35267341 GGCGGGACTGACCGACGGAGAGG + Intronic
1157480702 18:48051779-48051801 GGCGGGACACACCAATGGAGAGG + Intronic
1159402087 18:67951748-67951770 GGCTGGAGACACCAAGGGTGAGG + Intergenic
1160956064 19:1692181-1692203 GGGGGGACACACCAGGGGAGGGG - Intergenic
1161330948 19:3687649-3687671 TGCGGGACACAGCAAGGAAGGGG + Intronic
1164651460 19:29893684-29893706 GCCTGGACAGACCCATGGAGGGG + Intergenic
1168491449 19:56814115-56814137 GGCTGGACAGCCAAATGGAGAGG - Exonic
926355061 2:12034100-12034122 GGAGGAACACACCCATGGAATGG + Intergenic
926743029 2:16127805-16127827 GGCCTGACACATCAAAGGAGAGG - Intergenic
932588139 2:73044948-73044970 GGCAGGATACCCCGATGGAGGGG + Intronic
937294897 2:120804239-120804261 GGAGGTACGTACCAATGGAGGGG - Intronic
1170866144 20:20160012-20160034 GAAGGGACACTCCAATGGAGTGG - Intronic
1171401409 20:24875002-24875024 AGCAGGACACACCAAGGAAGGGG + Intergenic
1174614959 20:51828591-51828613 GACAGGAGACATCAATGGAGGGG + Intergenic
1175833264 20:61978540-61978562 GGCGAGACCAACCAAAGGAGGGG + Intronic
1175833279 20:61978584-61978606 GGCGAGACCAACCAAAGGAGGGG + Intronic
1175833316 20:61978694-61978716 GGCGAGACCAACCAAGGGAGGGG + Intronic
1176080028 20:63267844-63267866 GGCCGGACACACCAAGAGACAGG + Intronic
1177038215 21:16071580-16071602 GACGGCAGACACCAATGGGGGGG - Intergenic
1179033492 21:37740505-37740527 GGCGGGACAACTCAAAGGAGGGG - Intronic
1183365425 22:37404213-37404235 GGGGGGTGACACCAATGGAAGGG + Intronic
1184256704 22:43291034-43291056 GGCTGTACTCACCATTGGAGCGG + Exonic
1184719085 22:46298911-46298933 GGAGAAACACAGCAATGGAGAGG - Intronic
1184786222 22:46673252-46673274 GGCCGGGCACCCCCATGGAGTGG - Intronic
1184870558 22:47235260-47235282 GGATGGATACACGAATGGAGAGG - Intergenic
1185408772 22:50672260-50672282 GCAGGGAGACACCAAGGGAGAGG + Intergenic
950126774 3:10514526-10514548 GGCTGGACACAGGAATGCAGCGG - Intronic
950576769 3:13836855-13836877 GGCTGGAAAAACCAAGGGAGCGG + Intronic
961725140 3:128923213-128923235 GGAGGGACCCAACCATGGAGGGG + Intronic
974699650 4:65424052-65424074 GGTGGGACTCACCATTAGAGTGG - Intronic
980253263 4:130345722-130345744 GGCAGGTCACACCATAGGAGAGG - Intergenic
981777782 4:148390045-148390067 AGAGGGACACACCAGGGGAGAGG + Intronic
984747094 4:183232061-183232083 GGCCTGACACACCACTGGAAAGG + Intronic
986061591 5:4196877-4196899 GGCGGGACACATCCCTGGACTGG + Intergenic
995355662 5:111235612-111235634 TGTGTGACACACCAATGAAGTGG + Intronic
995646537 5:114319254-114319276 GGGTAGACACAGCAATGGAGAGG - Intergenic
999278575 5:150349343-150349365 GGAGGGAGATGCCAATGGAGGGG - Intergenic
1017024660 6:150171041-150171063 GGCGTGACCCTCCATTGGAGCGG + Intronic
1019663972 7:2242161-2242183 CGCGGGGAACACCAATGGCGGGG - Exonic
1022533407 7:31080883-31080905 GACAGGACTTACCAATGGAGGGG + Intronic
1027773197 7:82432724-82432746 GGCAGGAAGCACCAATAGAGTGG + Intronic
1033321392 7:140343026-140343048 GACGGGAGACAGCAATGGTGGGG + Intronic
1049614137 8:143568959-143568981 GGCGGGACACGGCCCTGGAGGGG + Intronic
1052857198 9:33414907-33414929 GACCAGACACACCATTGGAGCGG - Intergenic
1058989218 9:110239038-110239060 GGCAGGGCACAGCAATGGAGGGG - Intergenic
1061283131 9:129608755-129608777 GGCAGGACCCACGACTGGAGTGG - Intergenic
1189652253 X:43203249-43203271 GGCTGGACACCCCAATTGAGAGG + Intergenic