ID: 1157481159

View in Genome Browser
Species Human (GRCh38)
Location 18:48054653-48054675
Sequence CAGGCGGTTCTCGTGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157481159_1157481165 -10 Left 1157481159 18:48054653-48054675 CCGTCCACCACGAGAACCGCCTG No data
Right 1157481165 18:48054666-48054688 GAACCGCCTGGCATTTGGCTGGG No data
1157481159_1157481169 22 Left 1157481159 18:48054653-48054675 CCGTCCACCACGAGAACCGCCTG No data
Right 1157481169 18:48054698-48054720 ACTGGAAGCTTGCAATTTCCAGG No data
1157481159_1157481168 4 Left 1157481159 18:48054653-48054675 CCGTCCACCACGAGAACCGCCTG No data
Right 1157481168 18:48054680-48054702 TTGGCTGGGAAAGAACAAACTGG 0: 1
1: 0
2: 0
3: 25
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157481159 Original CRISPR CAGGCGGTTCTCGTGGTGGA CGG (reversed) Intronic