ID: 1157481161

View in Genome Browser
Species Human (GRCh38)
Location 18:48054657-48054679
Sequence ATGCCAGGCGGTTCTCGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 55}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157481161_1157481168 0 Left 1157481161 18:48054657-48054679 CCACCACGAGAACCGCCTGGCAT 0: 1
1: 0
2: 0
3: 7
4: 55
Right 1157481168 18:48054680-48054702 TTGGCTGGGAAAGAACAAACTGG 0: 1
1: 0
2: 0
3: 25
4: 249
1157481161_1157481169 18 Left 1157481161 18:48054657-48054679 CCACCACGAGAACCGCCTGGCAT 0: 1
1: 0
2: 0
3: 7
4: 55
Right 1157481169 18:48054698-48054720 ACTGGAAGCTTGCAATTTCCAGG 0: 1
1: 0
2: 1
3: 24
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157481161 Original CRISPR ATGCCAGGCGGTTCTCGTGG TGG (reversed) Intronic
900680518 1:3913767-3913789 AAGCCAGGAGGTTCTCGTTTTGG + Intergenic
902692379 1:18117981-18118003 ATGCCAGGCTCTTCAGGTGGTGG - Intronic
907330042 1:53664831-53664853 ATGCCAGGAGGTTTTCTTGGGGG + Intronic
920214866 1:204354966-204354988 ATTCCAGGGGATTCTCCTGGAGG + Intronic
1065092373 10:22247711-22247733 ATACCAAGTGATTCTCGTGGTGG - Intergenic
1077342124 11:2030864-2030886 ATGCCAGGGGGGTCTCCAGGTGG + Intergenic
1089975637 11:122729310-122729332 ATGCCACGCGGTTCTTGTTGAGG + Intronic
1090593680 11:128297628-128297650 ATGCAAGATGGTTCTCCTGGGGG + Intergenic
1202825110 11_KI270721v1_random:86053-86075 ATGCCAGGGGGGTCTCCAGGTGG + Intergenic
1092558921 12:9588871-9588893 ATCCCAGGCTGTTCACATGGTGG - Intergenic
1092669179 12:10843073-10843095 ATACCAGGTGGTGCTTGTGGAGG - Intronic
1097107290 12:56633296-56633318 ATGCCAGGAGTATCTGGTGGGGG - Intronic
1112254996 13:97821368-97821390 TTGCCATGCTGTTCTCATGGTGG + Intergenic
1118974668 14:70666311-70666333 ATGGCAGGCAGGTCTCATGGTGG - Intronic
1122319562 14:100845606-100845628 CCGCCAGGCGGACCTCGTGGAGG + Intergenic
1126462378 15:48927540-48927562 ATGCCAGGGGTTTCATGTGGTGG - Intronic
1127766424 15:62189781-62189803 ATGCCAGGCCTTTCTCAGGGTGG - Intergenic
1128187976 15:65660001-65660023 ACCCCAGACGGTTCTCTTGGAGG + Exonic
1130089215 15:80805402-80805424 GAGCCAGGCGGTTCCCGTGCTGG + Intronic
1138551658 16:57752017-57752039 AGGCCAGGAGGTACTCGTTGGGG - Exonic
1139752955 16:69120250-69120272 ATGGCGGCCGGTTCTCTTGGTGG - Exonic
1148002313 17:44397099-44397121 AGGCCAAGCTGTTCTAGTGGTGG - Intronic
1151360409 17:73585261-73585283 ATGCCATGCGCTTCTCGTAGTGG + Intronic
1157481161 18:48054657-48054679 ATGCCAGGCGGTTCTCGTGGTGG - Intronic
1161575533 19:5052492-5052514 AAGCCAGGCTGTTCTTGGGGTGG + Intronic
1162022649 19:7874675-7874697 GTGCCAGGTGGTTGTGGTGGGGG - Intergenic
1163105789 19:15122484-15122506 AAGCAAGGCGGCCCTCGTGGAGG - Intronic
1163829658 19:19541557-19541579 ATGCCAGGGGGCTCTTGTGCAGG + Intronic
1165146519 19:33734591-33734613 ATGGCAGGGCGTTCTCCTGGGGG - Intronic
1168352515 19:55684832-55684854 ATGCCAGGCGATGCCCATGGCGG + Intronic
926120781 2:10240258-10240280 GTACTAGGTGGTTCTCGTGGGGG - Intergenic
940237316 2:151525444-151525466 TTGCCAGGTGGTTCTAGTGTTGG - Intronic
1169193268 20:3670785-3670807 ATGCCTTGCGGTGCTGGTGGTGG + Intronic
1172013003 20:31857272-31857294 ATGCCAGGAGGTCCTCCAGGGGG + Intronic
1175903345 20:62368430-62368452 TGGCCAGCCGGTTCTGGTGGGGG + Intergenic
1179606568 21:42519611-42519633 CTGCCAGGGGGTTGGCGTGGAGG - Intronic
1179887014 21:44318611-44318633 GGGCCAGGCGGTTCTGATGGGGG - Intronic
1184758837 22:46533542-46533564 ATGCCAGGCGGAGCCCTTGGCGG + Intronic
1184860693 22:47171733-47171755 CTGTCAGGCGGTGGTCGTGGGGG + Intronic
949966767 3:9363233-9363255 ACTTCAGGCGGATCTCGTGGCGG + Exonic
954334660 3:49909255-49909277 AGGCCAGGAGGTTCTCGTTGGGG + Exonic
955367652 3:58325410-58325432 ATGCCAGGTGGATATCGAGGCGG + Intergenic
961561172 3:127731308-127731330 ATGCCTGGCTGCTCTCTTGGTGG + Intronic
964762122 3:160144469-160144491 ATGCCAGAGGGTTCTAGAGGAGG + Intergenic
966508167 3:180730620-180730642 TTCCCATGCTGTTCTCGTGGTGG - Intronic
968557730 4:1256298-1256320 TTCCCATGCTGTTCTCGTGGTGG + Intergenic
981974951 4:150715322-150715344 TTGCCAGGCTATTCTGGTGGTGG + Intronic
982036657 4:151352729-151352751 ATGGCAGGCAGTCCTGGTGGTGG - Intergenic
985789333 5:1916760-1916782 ATGCCAGGCGGTAAACCTGGCGG + Intergenic
987297246 5:16564675-16564697 ATCCCTGGTGCTTCTCGTGGAGG - Intronic
1008565024 6:52759286-52759308 ATGCCAGGCTGTTTGGGTGGTGG + Intronic
1019593447 7:1847329-1847351 ATGGCAGGCGGTGCTCGCGGAGG + Exonic
1022612870 7:31894819-31894841 CTCCCTGGGGGTTCTCGTGGTGG - Intronic
1023282462 7:38585160-38585182 ATGCCATGGGGTTCTTGTGAGGG - Intronic
1027967406 7:85029616-85029638 ATGCCAGGGGGATTTCCTGGTGG + Intronic
1029706262 7:102277942-102277964 GGGCCAGGCGGTTCTCCTGGGGG - Intronic
1038360779 8:26873895-26873917 TTCCCATGCTGTTCTCGTGGTGG - Intergenic
1039989342 8:42474948-42474970 ATTCCAGATGGTTCTCATGGTGG + Intronic
1047224854 8:122947724-122947746 AAACCAGGCGGTTCTCGGGGTGG + Intronic
1052528715 9:29655210-29655232 ACACCAGGGGGTTATCGTGGAGG + Intergenic
1053006890 9:34610872-34610894 AGGCCAGGGGGTGCTCCTGGGGG + Exonic
1186987797 X:15035836-15035858 ATGCCAGGCAGATTTTGTGGTGG + Intergenic
1199593512 X:149489028-149489050 CTCCCAGGCGGTTCTGATGGAGG + Intronic