ID: 1157481162

View in Genome Browser
Species Human (GRCh38)
Location 18:48054660-48054682
Sequence CAAATGCCAGGCGGTTCTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157481162_1157481168 -3 Left 1157481162 18:48054660-48054682 CCACGAGAACCGCCTGGCATTTG No data
Right 1157481168 18:48054680-48054702 TTGGCTGGGAAAGAACAAACTGG 0: 1
1: 0
2: 0
3: 25
4: 249
1157481162_1157481169 15 Left 1157481162 18:48054660-48054682 CCACGAGAACCGCCTGGCATTTG No data
Right 1157481169 18:48054698-48054720 ACTGGAAGCTTGCAATTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157481162 Original CRISPR CAAATGCCAGGCGGTTCTCG TGG (reversed) Intronic