ID: 1157481168

View in Genome Browser
Species Human (GRCh38)
Location 18:48054680-48054702
Sequence TTGGCTGGGAAAGAACAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 249}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157481162_1157481168 -3 Left 1157481162 18:48054660-48054682 CCACGAGAACCGCCTGGCATTTG 0: 1
1: 0
2: 0
3: 7
4: 47
Right 1157481168 18:48054680-48054702 TTGGCTGGGAAAGAACAAACTGG 0: 1
1: 0
2: 0
3: 25
4: 249
1157481159_1157481168 4 Left 1157481159 18:48054653-48054675 CCGTCCACCACGAGAACCGCCTG 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1157481168 18:48054680-48054702 TTGGCTGGGAAAGAACAAACTGG 0: 1
1: 0
2: 0
3: 25
4: 249
1157481161_1157481168 0 Left 1157481161 18:48054657-48054679 CCACCACGAGAACCGCCTGGCAT 0: 1
1: 0
2: 0
3: 7
4: 55
Right 1157481168 18:48054680-48054702 TTGGCTGGGAAAGAACAAACTGG 0: 1
1: 0
2: 0
3: 25
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157481168 Original CRISPR TTGGCTGGGAAAGAACAAAC TGG Intronic
900777957 1:4598898-4598920 TTGGCTGGGACAGGGCAAGCAGG + Intergenic
901926996 1:12572701-12572723 GGGGCTGGGAAAGAACACTCTGG - Intronic
902037172 1:13466477-13466499 AGGGCTGGGACAGAACAAAAAGG - Intergenic
902965275 1:19996390-19996412 GTGGCTGGGGAAGCTCAAACTGG + Intergenic
903819650 1:26092330-26092352 TTCCCTGGGGAAGAACAAAATGG + Intergenic
904106765 1:28091138-28091160 TTGGATGGGAAAGTACAAAGAGG - Intergenic
904736427 1:32637684-32637706 TTGACTGGAAAAGAGCAAAAGGG + Intronic
907884190 1:58577616-58577638 GGGGCTGGGAAAGAACGAAAAGG - Exonic
907910860 1:58824871-58824893 TTGGTTGGGGCAGAACCAACAGG + Intergenic
907983222 1:59505457-59505479 TTGGCTGGGAGAGTACAAAGTGG - Intronic
909859601 1:80588312-80588334 TTGGATGGGAAATAAAAAAAGGG + Intergenic
910267188 1:85350300-85350322 TTGGCAGGGAGAGAACAGGCAGG - Intronic
910783122 1:90963753-90963775 TAACCTGGGAAAGAAAAAACAGG + Intronic
914463108 1:147902901-147902923 TAGGCTGAGAAAGAACAATTGGG - Intergenic
914869428 1:151460188-151460210 TTGTCTGGGGAAGAATAAACAGG - Intergenic
914986907 1:152467519-152467541 TTGGCGGGGTAACAACAGACTGG - Intergenic
915348861 1:155212357-155212379 TTGGGTGGGCAGGAAGAAACAGG - Intronic
915352051 1:155232983-155233005 TTGGGTGGGCAGGAAGAAACAGG - Intergenic
916295242 1:163212001-163212023 TTGGCTCAGAAAGATCAAAAAGG - Intronic
919142825 1:193594601-193594623 TTTGGGGGGAAAGAATAAACTGG - Intergenic
919605892 1:199683509-199683531 CTGGCTGGGAAGGAAAAGACTGG - Intergenic
920617401 1:207507052-207507074 TTGGGTGGGAAGGAAGAAAATGG + Intronic
920633735 1:207678537-207678559 TTGGGTGGGAAGGAAGAAAATGG + Intronic
920738098 1:208553611-208553633 TTGACTGGGGAAGAAGAAAATGG + Intergenic
921704689 1:218308906-218308928 TTGGATGGGAAAGAACTAGTGGG + Intronic
921711809 1:218380451-218380473 TTAGCTAGGAAAAAAAAAACAGG - Intronic
921958968 1:221014036-221014058 TTGGCTGGGACTGAACAGATGGG + Intergenic
923610316 1:235486274-235486296 TGGGCTGGGCAAGCACTAACTGG + Intronic
924008129 1:239634813-239634835 TTGGCTGGAAAATAAGAGACTGG + Intronic
924645273 1:245871879-245871901 TTTGGTGGGAAAGAAAAAAATGG + Intronic
1063915547 10:10878327-10878349 TCAGATGGGAAAAAACAAACAGG + Intergenic
1064165133 10:12979346-12979368 TTGAAAGGGAAAGAACAAGCAGG - Intronic
1064558265 10:16569159-16569181 TTGCCTGGGAAGGACCAAAAAGG + Intergenic
1064766886 10:18684309-18684331 TTGACAAGGAAAGAAAAAACAGG - Intergenic
1065168167 10:23002198-23002220 TTGGCTTGGAAGGAACCACCTGG + Intronic
1065799139 10:29335114-29335136 GTGGCTGGGGAAGTTCAAACTGG + Intergenic
1065847323 10:29756701-29756723 TTGGCTGGGAAGCAACACAAGGG + Intergenic
1065859327 10:29858350-29858372 CTGGCTGGGAAAGGAGAAAGAGG + Intergenic
1066236008 10:33485393-33485415 TTCACTGGGAAAGAATAAATGGG - Intergenic
1066494162 10:35925848-35925870 TTGGCTGGGATAAAACTAAGAGG + Intergenic
1067792036 10:49295599-49295621 TGGGCTGGGAGAGTACTAACTGG + Intergenic
1068210118 10:53909994-53910016 GTGGCTGGGGAAGCCCAAACTGG + Intronic
1068959342 10:62850962-62850984 TTGCCTTGGCAAGAACAATCTGG - Intronic
1069724595 10:70569061-70569083 TGGGCTGGGAAAGAACCCCCGGG - Intergenic
1071527233 10:86365905-86365927 TTGGCAGGGCAAGATCAAAGAGG - Intronic
1072680841 10:97505229-97505251 ATGGCTGGGTAAGAAAAAAGAGG - Intronic
1072945797 10:99808943-99808965 TTGGCAGGTAAAGAAGCAACAGG + Intronic
1076379168 10:130013699-130013721 TCGGCTGGGAAGGAACAGAGTGG - Intergenic
1078514435 11:12009634-12009656 TTGGCTTGGAAAGACCAAGGTGG - Intronic
1079006134 11:16792611-16792633 TGGCCTGGGAAAGAACCCACAGG + Intronic
1080282139 11:30569422-30569444 ATGGTGAGGAAAGAACAAACAGG - Intronic
1081822240 11:46010648-46010670 TTGGCTGTGGAAGAAATAACAGG + Intronic
1082741025 11:56911279-56911301 TTGCCTTGGAAAGATCAAGCTGG + Intergenic
1083101967 11:60317519-60317541 TTGGCTGGAAAGGAGCAAAAGGG + Intergenic
1084871626 11:72102594-72102616 TTGTCTGGGAAGCAACAAAGAGG - Intronic
1085359120 11:75870278-75870300 TTGGCTTAGAAAGAACACCCAGG + Intronic
1087544865 11:99572404-99572426 CTTGCTCTGAAAGAACAAACCGG + Intronic
1088425538 11:109697243-109697265 TTGGCTGGGCCAGACCAAGCAGG - Intergenic
1088489245 11:110370884-110370906 AAGGCTGTGAAAGAACAAAAGGG - Intergenic
1088752513 11:112856443-112856465 TTGGCAGGGGGAGAACACACAGG + Intergenic
1089165163 11:116470272-116470294 TGGGGAGGGAAAGAAGAAACTGG + Intergenic
1089329684 11:117680732-117680754 TTGCCAAGGAAAGATCAAACAGG + Intronic
1089471798 11:118727231-118727253 TTGTCGGGAAATGAACAAACGGG - Intergenic
1091170208 11:133513417-133513439 TTGGCTGGGAAACAGGAGACAGG - Intronic
1094182475 12:27606676-27606698 TGGGCTGGGGAAGACCCAACTGG + Intronic
1094690334 12:32762216-32762238 TGGCCTGGGAAAGAACATGCTGG - Intergenic
1095238463 12:39828155-39828177 TTGGCTAGAAAAGAGCAAAAAGG - Intronic
1096738045 12:53671723-53671745 ATGGCTGGGTAAGAATTAACTGG + Intronic
1098201971 12:68065633-68065655 GTGGCTAGGAAAGAAAAAAAAGG - Intergenic
1099313239 12:81053810-81053832 TTGGCAGGGAGAGAACAAAGAGG + Intronic
1099323978 12:81188495-81188517 ATGGTTGGGAAAGGACAAAAGGG - Intronic
1100709654 12:97242229-97242251 TGAGCTGGGAATGAACAAAGAGG + Intergenic
1102353483 12:112212613-112212635 TTGGCTGGGAGAGAACTGAGGGG - Exonic
1102743264 12:115226926-115226948 TTGGCTTGGAAAGAGCAAATTGG - Intergenic
1104806444 12:131592324-131592346 TTGGCTGGGAAAGAATCTTCCGG - Intergenic
1105266623 13:18824639-18824661 TTGGGTGGGAAAGAACCCAAAGG + Intergenic
1105457290 13:20553221-20553243 TTGGGTTGGAAAGAACTTACTGG + Intergenic
1106118655 13:26838841-26838863 CTGGATGGGACAGAACAAAGTGG - Intergenic
1107248930 13:38333361-38333383 TTGCCTGGAAAAGAACACAAAGG + Intergenic
1108350624 13:49587688-49587710 TTGTTTAGGAAAAAACAAACAGG + Intergenic
1108741096 13:53339157-53339179 TTGCCTGGGAAAAAACATAGGGG + Intergenic
1108991848 13:56668393-56668415 TTGCCTGGGCAAGAACTAAATGG - Intergenic
1112142110 13:96655776-96655798 TTGGCTGGGAAAGGAGAGATGGG + Intronic
1113160109 13:107370353-107370375 TTTGCTTGGAGAGTACAAACAGG + Intronic
1113785430 13:112999925-112999947 TGGGCTGGGAATGAAGACACCGG + Intronic
1114348267 14:21820938-21820960 TTAGCTGGGAAAGAACTCAAGGG + Intergenic
1115218266 14:31033998-31034020 TTGGCTAAGAATGAACAACCAGG + Intronic
1116937037 14:50751371-50751393 TTTGCTGGGAGAATACAAACTGG - Intronic
1117435970 14:55715541-55715563 TCGTCTGGTAAACAACAAACTGG - Intergenic
1121505750 14:94475181-94475203 TTGGCAGGGAAGGAGCAGACAGG - Intronic
1202831905 14_GL000009v2_random:43449-43471 TTGGCTGGGAGAGAACCCAAAGG - Intergenic
1126160935 15:45612799-45612821 TTGACTTGCAAAGAATAAACAGG - Intronic
1128364891 15:66992322-66992344 TTGGCTTGGTAAGAAGAAAGAGG + Intergenic
1129669693 15:77600505-77600527 TTAGCTGGGAAAGAATGAAGGGG + Intergenic
1130035874 15:80361061-80361083 TTGACAGGGACAGAACCAACTGG - Intronic
1131796746 15:96026019-96026041 TTGGCTGAGGAAGAAAAATCAGG + Intergenic
1131885099 15:96903879-96903901 TTGGGTGGGAAGGAAAAAAAGGG - Intergenic
1137702902 16:50510007-50510029 TGGGCTAGGGAAGAACAAAGAGG - Intergenic
1138212417 16:55174519-55174541 TTGGCTGGGAAACATCAAAGGGG + Intergenic
1138735976 16:59250509-59250531 TTTGCTGGGAAAGACCCATCAGG + Intergenic
1138944857 16:61836788-61836810 TTGGCTGACAAAGAAAAACCAGG - Intronic
1139849206 16:69940525-69940547 TTGGCTGAGAATGAATTAACTGG - Exonic
1141732635 16:85833261-85833283 TTGGCTGGAAAAGCACAGAAGGG + Intergenic
1143347628 17:6261593-6261615 ATGGCTGGGAAAGGAAAGACAGG + Intergenic
1143532939 17:7516276-7516298 AGGGCTTGGAAAGAACAAAAAGG - Intergenic
1143983789 17:10893776-10893798 TTGGCCCAGAAAGAACAAAAAGG + Intergenic
1145998516 17:29117954-29117976 TGTGCTGGGCAAGAATAAACTGG + Intronic
1146367110 17:32237698-32237720 TTGGAAGGAAAAGAAGAAACTGG - Intronic
1151163036 17:72181928-72181950 ATGGCTGGGATAAAATAAACAGG - Intergenic
1151587785 17:75021377-75021399 TCTGCTGTGAAAGAACACACAGG + Intergenic
1152534635 17:80943417-80943439 TTGGGTGAGAAGGAAAAAACGGG + Intronic
1153691046 18:7594057-7594079 TTGACTGGGAAAGAACGGAGAGG - Intronic
1153976165 18:10270176-10270198 ATGACTGGGGGAGAACAAACAGG - Intergenic
1154332694 18:13442660-13442682 TTGGCTGGGCAGGAACAATGAGG - Intronic
1154421790 18:14236832-14236854 TTGGGTGGGAAAGAACCCAAAGG - Intergenic
1155710440 18:28870501-28870523 TAGGCAGAGAAAGAACAACCGGG - Intergenic
1157481168 18:48054680-48054702 TTGGCTGGGAAAGAACAAACTGG + Intronic
1157714346 18:49872993-49873015 TTAGTTGGGAAACAACACACTGG - Intronic
1158423979 18:57322594-57322616 TTGGCAGGGAAGGAACAGGCAGG + Intergenic
1158958420 18:62565358-62565380 CTGGCTGGAGAAGAACAACCTGG - Intronic
1159252936 18:65905474-65905496 TTGGCTAGGAAAGAACAGGCTGG - Intergenic
1159808715 18:72989820-72989842 TTCCCTGGGAAAGAACAAAACGG + Intergenic
1160358494 18:78248830-78248852 TTTGCAGGGAATGAGCAAACTGG + Intergenic
1161627084 19:5333558-5333580 TTAGCTGGGGAAGACCACACAGG - Intronic
1166339376 19:42128466-42128488 TTGGCTGGGTCACAACAAAATGG + Intronic
1166500168 19:43334542-43334564 TTGGCTGGGAAGGAACTCACTGG - Intergenic
1168455081 19:56500500-56500522 ATGGGTGGGAAATCACAAACAGG - Intergenic
925202721 2:1981886-1981908 TTGTCTGGGAAAGAAAGAAATGG + Intronic
926299261 2:11590413-11590435 TGGGCTGGGACAGAGCAAGCAGG - Intronic
927022127 2:19028533-19028555 TTGGCTATGAAAGCACAAATAGG + Intergenic
929723469 2:44397212-44397234 TAGGTTGGGAAAGTACAAAGAGG + Intronic
931994717 2:67829035-67829057 GTGGTTTGGAGAGAACAAACTGG - Intergenic
934496342 2:94804284-94804306 TTGGGTGGGAAAGAACCCAAAGG + Intergenic
934605391 2:95691295-95691317 CTTGCTGAGAAAGAACAGACAGG + Intergenic
936538852 2:113333842-113333864 CTTGCTGAGAAAGAACAGACAGG + Intergenic
936724719 2:115299338-115299360 GTGGCTGGCAAATAACAAACAGG + Intronic
937602389 2:123754469-123754491 TTGGGTGAGAAAGAAGAAAAGGG + Intergenic
937638324 2:124182858-124182880 TTGGCTGGTATGGAACAAAATGG - Intronic
937944717 2:127322382-127322404 TTGGGTGGGAAAAAATAAACAGG + Intronic
942061576 2:172232916-172232938 TAGGCTGGGGAAGTATAAACTGG - Intergenic
942308321 2:174630483-174630505 TTTCCTGGAAAAGAATAAACTGG - Intronic
943641810 2:190367934-190367956 TTGGGTGGGGAAGAAAAAAAAGG - Intronic
943959949 2:194251410-194251432 TTGGCATGGAAAGAAAGAACAGG + Intergenic
946067550 2:217001714-217001736 ATGGCTGGGATGGAACATACAGG + Intergenic
946791017 2:223300530-223300552 TTGGCTGGGAAAGAGCTGAGTGG - Intergenic
948309137 2:236972146-236972168 TGGGCTGGCAAAAAAGAAACCGG - Intergenic
948495157 2:238343957-238343979 TTTGCTGTGAAAAAAAAAACAGG - Intronic
1169305004 20:4482206-4482228 TTGTCTTGCAAAGAACCAACTGG + Intergenic
1169615909 20:7445298-7445320 TGGGTTGAGAAAGAACAACCTGG + Intergenic
1170795485 20:19543296-19543318 ATGGCAAGGAAAGAAAAAACCGG + Intronic
1171345948 20:24466660-24466682 TTGGGGGGGAAAGAAAAACCAGG + Intergenic
1172531774 20:35636020-35636042 TAGGCTGGGGAAGAACTACCAGG - Intronic
1173074125 20:39800611-39800633 GAGGCTGAGAAAGAAGAAACAGG - Intergenic
1173913759 20:46690520-46690542 TTTCCTGAGAAACAACAAACTGG - Intergenic
1177955122 21:27588636-27588658 GTGGCTGTGAAAGAATAAAGGGG + Intergenic
1179278212 21:39910885-39910907 ATGGCAGGGACAGAACAAATGGG - Intronic
1180115783 21:45704114-45704136 TTGAGTTGGGAAGAACAAACTGG + Intronic
1182145938 22:27996696-27996718 TCGGCTGGGAAAGACCAACTGGG + Intronic
1182747726 22:32618369-32618391 GTGGATGGGAACAAACAAACCGG + Intronic
1183843148 22:40517295-40517317 CTGGCAGGGAAAGATAAAACAGG + Intronic
1184197231 22:42937968-42937990 TTAGCTGGGAAAAATCAACCAGG - Intronic
1184288620 22:43486382-43486404 TTGGGGTGGGAAGAACAAACGGG + Intronic
1184616979 22:45645153-45645175 AAGGCTGAGCAAGAACAAACGGG + Intergenic
949282548 3:2362781-2362803 TTGGATGGGAAAGAGAAAAAGGG + Intronic
949504803 3:4717348-4717370 TTAGCTGGAAAAGAAAAAAGGGG - Exonic
950477436 3:13222993-13223015 ATGGATGGGAAATAACAAAAAGG + Intergenic
950881393 3:16325645-16325667 TTGGCTGAGAAAGAACATGGTGG + Intronic
952664257 3:35885530-35885552 TTGGCTTTGAAAGCACAAACTGG - Intergenic
952819116 3:37470819-37470841 ATGCCTGGGAAAGATCTAACAGG + Intronic
953194802 3:40722286-40722308 AAGGCTGGGCAAGAAGAAACTGG + Intergenic
954608416 3:51931317-51931339 TTGGCTGGCAATGGACACACTGG - Intergenic
955868709 3:63414070-63414092 CTGCCTGAGAAAGAACAACCAGG - Intronic
957420006 3:79955217-79955239 TAGTCAGGGAAAGAACACACTGG + Intergenic
957924235 3:86788250-86788272 GTGGCTTGGAAAGAAAAAAGAGG - Intergenic
958045722 3:88281627-88281649 TATCCTGGGAAAGAACAAAGAGG - Intergenic
958116925 3:89232406-89232428 CTGGGTGGGAAAGGACAGACTGG + Intronic
959842734 3:110997652-110997674 GTGGCTGGAGAAGAACAAACAGG + Intergenic
961702504 3:128757236-128757258 ATGGCTGGGAGAGAAAAAAATGG - Intronic
962562566 3:136622318-136622340 GTGGGGGGGAAAGAAGAAACAGG + Intronic
963543683 3:146627543-146627565 TTTGCTGGGGAAGGACAAATTGG - Intergenic
964988740 3:162778584-162778606 TTAGCACGGAAAGAACAAATTGG - Intergenic
966057467 3:175713273-175713295 TTGGGTGGGCAAGTAAAAACTGG - Intronic
966330106 3:178802407-178802429 GGGGCAGGGAAAGAACAAAGTGG - Intronic
966820296 3:183918889-183918911 TGAGCTGGGAAAGCACAAAATGG + Intergenic
1202737774 3_GL000221v1_random:23084-23106 TTGGCTGGGAGAGAACCCAAAGG - Intergenic
974351152 4:60748293-60748315 TTGGCTGGAAAAAACAAAACTGG + Intergenic
975306943 4:72860708-72860730 TTGGCTCAGAAAAAACACACTGG + Intergenic
975736442 4:77385828-77385850 CTGTCTTGGAAAGAACAAACAGG - Intronic
976512654 4:85929397-85929419 ATGGCTGGGAAGGAACACAGAGG + Intronic
976759389 4:88531962-88531984 ATGGCTGGAAAAGCAGAAACAGG - Intronic
979097457 4:116569015-116569037 ATGGCTGGGGAACAACACACTGG + Intergenic
979133148 4:117074585-117074607 TTGCCTGGTAAAGAACAAGTTGG + Intergenic
980800577 4:137744137-137744159 GGGGCTGGGTAACAACAAACTGG - Intergenic
980815007 4:137934602-137934624 TTGCCTGGAAAAGGACAAAAAGG + Intergenic
981012813 4:139943286-139943308 TTGACAGGAAAAGAACAAAGAGG + Intronic
981299948 4:143175752-143175774 TTCGGTGGGGAAGATCAAACAGG + Intergenic
982738236 4:159029301-159029323 TTGACTGGGAAAGGACATACAGG + Intronic
983669330 4:170217252-170217274 TTGACTTGGAAAGAACTAAATGG + Intergenic
984256212 4:177392903-177392925 TTGGCTAGCAGAGGACAAACAGG - Intergenic
987910775 5:24141241-24141263 TTGGGTGAGAAAGAAGAAAAAGG - Intronic
988837249 5:35045622-35045644 TTGGATGAGCAAGCACAAACAGG + Intronic
989437571 5:41432879-41432901 TTTCCTGGGAAAGGACAAAAAGG + Intronic
991249274 5:64541822-64541844 TTGGTAGACAAAGAACAAACTGG - Intronic
991617890 5:68516330-68516352 GTAGCTGGGAAAGAACGCACAGG - Intergenic
993661441 5:90641453-90641475 TAAGCTAGGAAAGAAAAAACTGG - Intronic
993711941 5:91234000-91234022 TTGGCTGTGAAAGAGGAAAGAGG - Intergenic
994945416 5:106381525-106381547 TTTACTGGGAAAGTAAAAACAGG + Intergenic
995072193 5:107937028-107937050 TTGGATGGGAAAAAACACAATGG + Intronic
995410369 5:111850503-111850525 TTGCCTTGGAAAGAAAAGACAGG - Intronic
995618842 5:114000212-114000234 GTTGCTGAGAAAGAACACACAGG + Intergenic
996188115 5:120504688-120504710 TTGGCTGGGAAGCAAGAAACTGG - Intronic
997361884 5:133300405-133300427 TTGGCTCAGACAGAACAAACAGG - Intronic
998810532 5:145961969-145961991 TTGCCTGGGAATGAAGAAAGCGG - Intronic
1000647347 5:163774532-163774554 ATGGCTGGTAAAAAACACACGGG - Intergenic
1002163718 5:177332243-177332265 TTGTCTGGGGGAGAAGAAACGGG + Exonic
1002380645 5:178826029-178826051 TTGGCTAGGAAGCCACAAACGGG - Intergenic
1004607146 6:17205486-17205508 ATGGCAGGCAAAGAACAGACTGG + Intergenic
1005564751 6:27079753-27079775 TTGTCTGTGAAACAACAAATGGG - Intergenic
1010879058 6:81145469-81145491 TTGGCTGTGTTAGAATAAACAGG - Intergenic
1011978438 6:93338010-93338032 TTGGGAGGGAGAGAACAAAAGGG + Intronic
1012220709 6:96646061-96646083 TTGTCTGGGAATGAGAAAACTGG - Intergenic
1013942525 6:115681805-115681827 ATGGCTGGGAAAGATGAGACAGG - Intergenic
1015544948 6:134352218-134352240 TTGGATGGGAAAGCAACAACAGG - Intergenic
1016385207 6:143524193-143524215 TTTGCTAGGAAAGAACAAAGTGG - Intergenic
1018442818 6:163828717-163828739 CTGGGTGGAAAAGAACAAAAAGG - Intergenic
1020105521 7:5420716-5420738 TGGGCGAGAAAAGAACAAACCGG - Intronic
1023937889 7:44752287-44752309 TTAGCTGGGCAAAAACTAACCGG - Intronic
1025140204 7:56456678-56456700 TTGCCTAGGAAAAAACAAAAGGG - Intergenic
1026040789 7:66866076-66866098 TTGGCTTGGAAACTACAAAAGGG - Intergenic
1027677049 7:81172933-81172955 TTGGTTAGGAAATAACACACAGG - Intergenic
1028548981 7:92035668-92035690 TTGTATGGGAAAGAAGAAACAGG - Intronic
1029072920 7:97914395-97914417 TTGGCTAGGAAAGTCAAAACTGG + Intergenic
1029130028 7:98322768-98322790 TGATCTGGGAAAGAACAAGCTGG - Intronic
1032794413 7:135266279-135266301 TTGGGTGGGAAAGAACAGGATGG + Intergenic
1035647873 8:1242427-1242449 GTGGCCAGGAAAGAACAGACGGG - Intergenic
1037726857 8:21490048-21490070 TTGGATGGGAAGGAACACAGAGG + Intergenic
1038321301 8:26529806-26529828 ATGGCTGGAAAAGAATTAACTGG + Intronic
1038586888 8:28797826-28797848 TTGGGTGGGAGAGAAAAAAGAGG - Intronic
1038669254 8:29569097-29569119 ATGGCTGGAAAAGAAGAAAGAGG - Intergenic
1038715190 8:29985153-29985175 CTGTCTGGGAAATAACAAAGTGG - Intergenic
1039291058 8:36094983-36095005 TTGTCTGGGAGAGAAAAAACTGG - Intergenic
1041648480 8:60277834-60277856 TTGGAAGGGAAAGAACAATAAGG + Intronic
1042520447 8:69706243-69706265 TTGTCTGGGAATGCACAAACAGG + Intronic
1042786791 8:72556716-72556738 TAGTCAGGGAAAGAACAAAAAGG + Intronic
1046051377 8:109026536-109026558 GTGGGTGGGAAAGAACATTCAGG + Intergenic
1046964187 8:120144978-120145000 TTGTCAGGCAAAAAACAAACTGG + Intronic
1048019738 8:130527277-130527299 TGGGCTGGGAAAGAACAGGCAGG + Intergenic
1048979449 8:139695325-139695347 TGGACTGGGAAAGCACATACAGG + Intronic
1049059976 8:140269000-140269022 TTGGCTGGGAAGGAACATGTGGG + Intronic
1051188617 9:14487085-14487107 TTGTCTGGATAAAAACAAACTGG + Intergenic
1052705067 9:31984707-31984729 CTGCCTGGGAAAGAAAACACAGG - Intergenic
1053168809 9:35863717-35863739 ATGGCTGGGGAAGGACACACTGG + Intergenic
1053660799 9:40276163-40276185 TTGGGTGGGAAAGAACCCAAAGG - Intronic
1053911177 9:42905508-42905530 TTGGGTGGGAAAGAACCCAAAGG - Intergenic
1054372921 9:64422379-64422401 TTGGGTGGGAAAGAACCCAAAGG - Intergenic
1054523811 9:66100121-66100143 TTGGGTGGGAAAGAACCCAAAGG + Intergenic
1054680551 9:67912156-67912178 TTGGGTGGGAAAGAACCCAAAGG - Intergenic
1055496467 9:76860061-76860083 TTGGCTGGGGATGAACTCACAGG + Intronic
1056294494 9:85178819-85178841 TTGGCTGGGAAAGAAACAATGGG - Intergenic
1056532297 9:87498152-87498174 CTGGCTGGGAAAGCAAAAGCTGG - Intronic
1059336450 9:113572168-113572190 TTGGCGGGGGCAGAACACACAGG + Intronic
1059605639 9:115832098-115832120 CTGGCATGGAAATAACAAACAGG - Intergenic
1059686932 9:116646682-116646704 TGGGGAGGGAAAGAAGAAACTGG + Intronic
1060265992 9:122111783-122111805 TTGGCTGGGACAGAAAGGACAGG - Intergenic
1060998218 9:127886785-127886807 CTGGCTGGGACAGAGCAGACGGG + Intronic
1062718806 9:138024122-138024144 CTGGCTTGGAAAGAACAAAGTGG + Intronic
1203706503 Un_KI270742v1:53528-53550 TTGGCTGGGAGAGAACCCAAAGG - Intergenic
1187188478 X:17010495-17010517 GATGCTGGGAAAGAACAAAGTGG - Intronic
1189907210 X:45773749-45773771 TTGCCTGGGTAAAGACAAACTGG - Intergenic
1195704821 X:107731134-107731156 ATGGTAGGGAAAGAACAAGCTGG + Intronic
1195729251 X:107949206-107949228 GTGGCTGGGGAAGCTCAAACTGG - Intergenic
1195888133 X:109662897-109662919 TGGGCAGGGAAATAGCAAACAGG - Intronic
1195953315 X:110301650-110301672 TTGGCTGGGAAAGTACAAGTCGG - Intronic
1198780456 X:140229646-140229668 TTTGCTGGGAAAGCAGAATCTGG - Intergenic
1201345509 Y:12980064-12980086 ATGGCTGGGAAAGGGGAAACAGG + Intergenic